Incidental Mutation 'R0328:Arhgap39'
ID25902
Institutional Source Beutler Lab
Gene Symbol Arhgap39
Ensembl Gene ENSMUSG00000033697
Gene NameRho GTPase activating protein 39
SynonymsD15Wsu169e
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76723985-76818170 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 76751952 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821] [ENSMUST00000176855]
Predicted Effect probably benign
Transcript: ENSMUST00000036176
SMART Domains Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 759 904 2.3e-32 PFAM
RhoGAP 932 1105 5.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077821
SMART Domains Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 756 874 3.3e-25 PFAM
RhoGAP 901 1074 5.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176855
SMART Domains Protein: ENSMUSP00000135043
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177011
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Arhgap39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Arhgap39 APN 15 76737815 splice site probably benign
IGL01586:Arhgap39 APN 15 76730438 missense probably benign 0.16
IGL01693:Arhgap39 APN 15 76725967 missense probably null 1.00
IGL02017:Arhgap39 APN 15 76737037 missense probably damaging 0.98
IGL02508:Arhgap39 APN 15 76724984 makesense probably null
IGL03333:Arhgap39 APN 15 76726732 missense probably benign 0.05
R0432:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0479:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0549:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0551:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R1054:Arhgap39 UTSW 15 76751559 missense probably benign
R1830:Arhgap39 UTSW 15 76735183 missense probably damaging 1.00
R2421:Arhgap39 UTSW 15 76725146 missense probably damaging 1.00
R2497:Arhgap39 UTSW 15 76725385 missense probably damaging 1.00
R3909:Arhgap39 UTSW 15 76751888 missense probably benign 0.03
R4410:Arhgap39 UTSW 15 76725512 unclassified probably benign
R4626:Arhgap39 UTSW 15 76737637 missense possibly damaging 0.92
R4790:Arhgap39 UTSW 15 76726731 missense possibly damaging 0.51
R4792:Arhgap39 UTSW 15 76741517 missense possibly damaging 0.92
R4911:Arhgap39 UTSW 15 76737805 missense probably damaging 1.00
R5225:Arhgap39 UTSW 15 76725515 unclassified probably benign
R5417:Arhgap39 UTSW 15 76735101 missense possibly damaging 0.80
R5443:Arhgap39 UTSW 15 76797925 intron probably benign
R5521:Arhgap39 UTSW 15 76765494 missense possibly damaging 0.66
R5686:Arhgap39 UTSW 15 76726633 missense probably damaging 1.00
R5747:Arhgap39 UTSW 15 76741535 missense possibly damaging 0.68
R5785:Arhgap39 UTSW 15 76737418 missense probably benign
R5879:Arhgap39 UTSW 15 76751807 missense probably damaging 1.00
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6049:Arhgap39 UTSW 15 76727401 critical splice donor site probably null
R6143:Arhgap39 UTSW 15 76730406 nonsense probably null
R6232:Arhgap39 UTSW 15 76736512 missense probably damaging 1.00
R6276:Arhgap39 UTSW 15 76737536 missense probably benign 0.06
R6277:Arhgap39 UTSW 15 76735137 missense probably damaging 1.00
R6305:Arhgap39 UTSW 15 76737702 missense probably benign 0.31
R6587:Arhgap39 UTSW 15 76737499 missense probably damaging 1.00
R7153:Arhgap39 UTSW 15 76765491 missense probably benign 0.09
R7447:Arhgap39 UTSW 15 76765597 start gained probably benign
R7658:Arhgap39 UTSW 15 76737417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGACTCAGTGTTCTGTTTCAGCGTC -3'
(R):5'- ACACGGCCTTGTATAGTGTGATTTACC -3'

Sequencing Primer
(F):5'- CAGAGGAATGATGTCGCAGTTC -3'
(R):5'- GAACACCAGATACAGGAGCA -3'
Posted On2013-04-16