Mutagenetix > Incidental Mutations

Incidental Mutation 'R3236:Agbl3'

259026

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

040618-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3236 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 34823087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115016] [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000115017] [ENSMUST00000115017] [ENSMUST00000148834] [ENSMUST00000148834] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably null
Transcript: ENSMUST00000115016

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115016

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115016

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115017

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115017

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115017

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118782

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (64/65)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
5730455P16Rik	G	A	11: 80,368,170	L255F	probably damaging	Het
9130011E15Rik	A	T	19: 45,975,283		probably benign	Het
Aff2	T	A	X: 69,863,937	V1175E	possibly damaging	Het
Atm	T	A	9: 53,479,748	D1842V	probably benign	Het
Bcar3	C	A	3: 122,524,996	Q678K	probably benign	Het
Ccdc88a	A	G	11: 29,447,995	T243A	possibly damaging	Het
Col5a3	G	T	9: 20,807,653	N268K	unknown	Het
Col6a1	G	A	10: 76,711,320	T737M	unknown	Het
Cyp3a25	T	C	5: 146,003,128		probably benign	Het
Dnah17	T	C	11: 118,094,854	T1466A	probably benign	Het
Dnah9	G	A	11: 65,954,989	T3023I	probably benign	Het
Ecm1	G	T	3: 95,734,846	Q476K	possibly damaging	Het
Eml6	A	G	11: 29,831,097		probably null	Het
Fbxo18	T	C	2: 11,769,826	D36G	probably damaging	Het
Fyb	A	C	15: 6,630,116	D434A	probably damaging	Het
Gm5478	A	G	15: 101,644,303	Y398H	probably damaging	Het
H2-Q6	C	A	17: 35,425,700	T155K	probably damaging	Het
Hk1	T	C	10: 62,296,019		probably null	Het
Kdm6b	A	G	11: 69,406,366	Y387H	probably damaging	Het
Lipn	A	G	19: 34,068,738	N37S	probably benign	Het
Lrig3	G	A	10: 125,997,187	C310Y	probably damaging	Het
Map6	T	A	7: 99,336,824	V645E	probably damaging	Het
Memo1	A	T	17: 74,202,352	I224K	probably damaging	Het
Morc2a	T	C	11: 3,683,612	I602T	probably benign	Het
N4bp3	A	T	11: 51,645,934	F104Y	probably damaging	Het
Ndrg3	T	A	2: 156,944,037	I161F	probably damaging	Het
Notch3	T	C	17: 32,158,461	R214G	probably damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr116	T	C	17: 37,624,236	E133G	possibly damaging	Het
Olfr1178	T	C	2: 88,391,406	I53T	probably benign	Het
Pdgfra	T	C	5: 75,167,936	V243A	probably damaging	Het
Piwil4	A	G	9: 14,700,248		probably benign	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Pon2	A	T	6: 5,266,986	N252K	possibly damaging	Het
Ptf1a	T	C	2: 19,445,907	F16S	probably damaging	Het
Rasgrp1	A	G	2: 117,291,812	Y366H	probably benign	Het
Rbfox1	G	A	16: 7,408,028	V353I	possibly damaging	Het
Rrh	T	C	3: 129,811,711	Y110C	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf4	T	A	16: 90,260,217	D82V	unknown	Het
Serhl	C	A	15: 83,104,403	P177Q	probably damaging	Het
Setdb1	A	G	3: 95,338,754	V619A	probably damaging	Het
Sf3b3	A	G	8: 110,812,020	S1123P	probably damaging	Het
Slc1a3	T	C	15: 8,639,123	I453V	probably damaging	Het
Slf2	A	G	19: 44,942,334	I617V	probably benign	Het
Snrnp200	T	A	2: 127,221,882	D660E	probably damaging	Het
Spata22	T	A	11: 73,345,887	F340I	probably damaging	Het
Speer4e	T	A	5: 14,934,925	E206D	possibly damaging	Het
Stard6	T	A	18: 70,500,486	M188K	probably damaging	Het
Stat6	G	A	10: 127,652,222	V282I	possibly damaging	Het
Supt20	T	C	3: 54,709,080	S253P	possibly damaging	Het
Szt2	A	C	4: 118,383,034		probably null	Het
Thsd4	C	A	9: 60,394,387	K208N	probably benign	Het
Thsd7b	C	T	1: 130,218,118	Q1588*	probably null	Het
Tmem167	C	T	13: 90,104,380	R52C	probably benign	Het
Ttn	T	C	2: 76,899,409		probably benign	Het
Usp39	G	A	6: 72,338,389		probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vmn2r24	C	T	6: 123,779,025	Q19*	probably null	Het
Vps13b	G	A	15: 35,910,304	E3405K	probably benign	Het
Zgrf1	A	G	3: 127,613,375	D1597G	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATTTCTAAATTGTCTGAGGCCAC -3'
(R):5'- ACAAGTGAGGTAAATTAGGTCACC -3'

Sequencing Primer
(F):5'- TGTCTGAGGCCACCAAATAATAAAG -3'
(R):5'- GGTCACCATATCTGACATTAACAAG -3'

Posted On

2015-01-23