Incidental Mutation 'R0328:Prkag1'
ID25904
Institutional Source Beutler Lab
Gene Symbol Prkag1
Ensembl Gene ENSMUSG00000067713
Gene Nameprotein kinase, AMP-activated, gamma 1 non-catalytic subunit
SynonymsPrkaac
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98812797-98831521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98815682 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 44 (D44A)
Ref Sequence ENSEMBL: ENSMUSP00000155591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168846] [ENSMUST00000229297] [ENSMUST00000230560]
Predicted Effect probably damaging
Transcript: ENSMUST00000168846
AA Change: D75A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132499
Gene: ENSMUSG00000067713
AA Change: D75A

DomainStartEndE-ValueType
CBS 46 95 8.18e-7 SMART
CBS 127 176 3.12e-12 SMART
CBS 202 250 1.01e-11 SMART
CBS 274 322 2.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181510
Predicted Effect probably damaging
Transcript: ENSMUST00000229297
AA Change: D44A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230113
Predicted Effect probably damaging
Transcript: ENSMUST00000230560
AA Change: D44A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.6281 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hemolytic anemia, extramedullary hematopoiesis, and iron accumulation in the spleen, liver, and Kupffer cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Prkag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Prkag1 APN 15 98814531 missense probably damaging 1.00
IGL02621:Prkag1 APN 15 98814028 missense probably damaging 1.00
IGL02804:Prkag1 APN 15 98815504 missense probably damaging 1.00
IGL03197:Prkag1 APN 15 98815177 splice site probably benign
R1188:Prkag1 UTSW 15 98814598 missense probably damaging 0.99
R1493:Prkag1 UTSW 15 98813670 missense probably benign 0.02
R1663:Prkag1 UTSW 15 98815895 missense probably damaging 1.00
R2115:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R2216:Prkag1 UTSW 15 98815946 start codon destroyed probably null 1.00
R5037:Prkag1 UTSW 15 98815887 missense possibly damaging 0.51
R5175:Prkag1 UTSW 15 98815715 missense possibly damaging 0.82
R5597:Prkag1 UTSW 15 98815908 missense probably damaging 1.00
R6185:Prkag1 UTSW 15 98825714 missense probably benign 0.00
R6359:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R6429:Prkag1 UTSW 15 98814523 missense probably damaging 1.00
R7777:Prkag1 UTSW 15 98814597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCTCGCAGGGGAAAACCAG -3'
(R):5'- TGTGCAGAGACCCCGGAATCAAAC -3'

Sequencing Primer
(F):5'- ACCAGGGCTGACTTATAGTATCG -3'
(R):5'- CCACAAGTTCCAAGTTGGTG -3'
Posted On2013-04-16