Incidental Mutation 'R3236:N4bp3'
ID 259041
Institutional Source Beutler Lab
Gene Symbol N4bp3
Ensembl Gene ENSMUSG00000001053
Gene Name NEDD4 binding protein 3
Synonyms C330016O10Rik
MMRRC Submission 040618-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3236 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 51533908-51541664 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51536761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 104 (F104Y)
Ref Sequence ENSEMBL: ENSMUSP00000123658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001080] [ENSMUST00000142721] [ENSMUST00000156835]
AlphaFold Q8C7U1
Predicted Effect possibly damaging
Transcript: ENSMUST00000001080
AA Change: F104Y

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001080
Gene: ENSMUSG00000001053
AA Change: F104Y

DomainStartEndE-ValueType
low complexity region 176 207 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
coiled coil region 295 334 N/A INTRINSIC
Pfam:Fez1 359 442 2.3e-21 PFAM
Pfam:Fez1 433 519 4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142721
AA Change: F104Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000156835
AA Change: F104Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0977 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
5730455P16Rik G A 11: 80,258,996 (GRCm39) L255F probably damaging Het
Aff2 T A X: 68,907,543 (GRCm39) V1175E possibly damaging Het
Agbl3 A G 6: 34,800,022 (GRCm39) probably null Het
Armh3 A T 19: 45,963,722 (GRCm39) probably benign Het
Atm T A 9: 53,391,048 (GRCm39) D1842V probably benign Het
Bcar3 C A 3: 122,318,645 (GRCm39) Q678K probably benign Het
Ccdc88a A G 11: 29,397,995 (GRCm39) T243A possibly damaging Het
Col5a3 G T 9: 20,718,949 (GRCm39) N268K unknown Het
Col6a1 G A 10: 76,547,154 (GRCm39) T737M unknown Het
Cyp3a25 T C 5: 145,939,938 (GRCm39) probably benign Het
Dnah17 T C 11: 117,985,680 (GRCm39) T1466A probably benign Het
Dnah9 G A 11: 65,845,815 (GRCm39) T3023I probably benign Het
Ecm1 G T 3: 95,642,158 (GRCm39) Q476K possibly damaging Het
Eml6 A G 11: 29,781,097 (GRCm39) probably null Het
Fbh1 T C 2: 11,774,637 (GRCm39) D36G probably damaging Het
Fyb1 A C 15: 6,659,597 (GRCm39) D434A probably damaging Het
Gm5478 A G 15: 101,552,738 (GRCm39) Y398H probably damaging Het
H2-Q6 C A 17: 35,644,676 (GRCm39) T155K probably damaging Het
Hk1 T C 10: 62,131,798 (GRCm39) probably null Het
Kdm6b A G 11: 69,297,192 (GRCm39) Y387H probably damaging Het
Lipn A G 19: 34,046,138 (GRCm39) N37S probably benign Het
Lrig3 G A 10: 125,833,056 (GRCm39) C310Y probably damaging Het
Map6 T A 7: 98,986,031 (GRCm39) V645E probably damaging Het
Memo1 A T 17: 74,509,347 (GRCm39) I224K probably damaging Het
Morc2a T C 11: 3,633,612 (GRCm39) I602T probably benign Het
Ndrg3 T A 2: 156,785,957 (GRCm39) I161F probably damaging Het
Notch3 T C 17: 32,377,435 (GRCm39) R214G probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or14j10 T C 17: 37,935,127 (GRCm39) E133G possibly damaging Het
Or4p7 T C 2: 88,221,750 (GRCm39) I53T probably benign Het
Pdgfra T C 5: 75,328,597 (GRCm39) V243A probably damaging Het
Piwil4 A G 9: 14,611,544 (GRCm39) probably benign Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pon2 A T 6: 5,266,986 (GRCm39) N252K possibly damaging Het
Ptf1a T C 2: 19,450,718 (GRCm39) F16S probably damaging Het
Rasgrp1 A G 2: 117,122,293 (GRCm39) Y366H probably benign Het
Rbfox1 G A 16: 7,225,892 (GRCm39) V353I possibly damaging Het
Rrh T C 3: 129,605,360 (GRCm39) Y110C probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scaf4 T A 16: 90,057,105 (GRCm39) D82V unknown Het
Serhl C A 15: 82,988,604 (GRCm39) P177Q probably damaging Het
Setdb1 A G 3: 95,246,065 (GRCm39) V619A probably damaging Het
Sf3b3 A G 8: 111,538,652 (GRCm39) S1123P probably damaging Het
Slc1a3 T C 15: 8,668,607 (GRCm39) I453V probably damaging Het
Slf2 A G 19: 44,930,773 (GRCm39) I617V probably benign Het
Snrnp200 T A 2: 127,063,802 (GRCm39) D660E probably damaging Het
Spata22 T A 11: 73,236,713 (GRCm39) F340I probably damaging Het
Speer4e1 T A 5: 14,984,939 (GRCm39) E206D possibly damaging Het
Stard6 T A 18: 70,633,557 (GRCm39) M188K probably damaging Het
Stat6 G A 10: 127,488,091 (GRCm39) V282I possibly damaging Het
Supt20 T C 3: 54,616,501 (GRCm39) S253P possibly damaging Het
Szt2 A C 4: 118,240,231 (GRCm39) probably null Het
Thsd4 C A 9: 60,301,670 (GRCm39) K208N probably benign Het
Thsd7b C T 1: 130,145,855 (GRCm39) Q1588* probably null Het
Tmem167 C T 13: 90,252,499 (GRCm39) R52C probably benign Het
Ttn T C 2: 76,729,753 (GRCm39) probably benign Het
Usp39 G A 6: 72,315,372 (GRCm39) probably benign Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Vmn2r24 C T 6: 123,755,984 (GRCm39) Q19* probably null Het
Vps13b G A 15: 35,910,450 (GRCm39) E3405K probably benign Het
Zgrf1 A G 3: 127,407,024 (GRCm39) D1597G probably damaging Het
Other mutations in N4bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:N4bp3 APN 11 51,536,143 (GRCm39) missense probably benign 0.28
IGL02130:N4bp3 APN 11 51,534,773 (GRCm39) missense possibly damaging 0.77
IGL02265:N4bp3 APN 11 51,534,645 (GRCm39) missense probably benign 0.14
IGL02516:N4bp3 APN 11 51,535,161 (GRCm39) missense probably benign 0.00
R1435:N4bp3 UTSW 11 51,535,167 (GRCm39) missense probably damaging 0.97
R2270:N4bp3 UTSW 11 51,535,132 (GRCm39) missense probably benign 0.00
R2291:N4bp3 UTSW 11 51,536,930 (GRCm39) missense probably damaging 1.00
R3237:N4bp3 UTSW 11 51,536,761 (GRCm39) missense probably damaging 1.00
R4695:N4bp3 UTSW 11 51,535,306 (GRCm39) splice site probably null
R5154:N4bp3 UTSW 11 51,536,139 (GRCm39) missense probably benign 0.09
R5839:N4bp3 UTSW 11 51,536,909 (GRCm39) missense probably benign
R6632:N4bp3 UTSW 11 51,534,776 (GRCm39) missense possibly damaging 0.94
R7346:N4bp3 UTSW 11 51,536,433 (GRCm39) missense probably benign 0.14
R8369:N4bp3 UTSW 11 51,535,253 (GRCm39) missense probably damaging 1.00
R8898:N4bp3 UTSW 11 51,535,256 (GRCm39) missense probably benign 0.00
R9326:N4bp3 UTSW 11 51,535,313 (GRCm39) missense probably benign 0.03
R9595:N4bp3 UTSW 11 51,536,932 (GRCm39) missense probably damaging 1.00
R9604:N4bp3 UTSW 11 51,536,493 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCCTCTGAGAATACAGGG -3'
(R):5'- CTTTTCCCCTGAAGAACTTCGG -3'

Sequencing Primer
(F):5'- CCCTCTGAGAATACAGGGTAGTATC -3'
(R):5'- TGAAGAACTTCGGGCCGC -3'
Posted On 2015-01-23