Incidental Mutation 'R3236:2700049A03Rik'
ID259048
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene NameRIKEN cDNA 2700049A03 gene
Synonymstalpid3
MMRRC Submission 040618-MU
Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3236 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71136848-71243303 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 71164546 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 685 (E685*)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
Predicted Effect probably null
Transcript: ENSMUST00000045907
AA Change: E685*
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685*

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149564
AA Change: E685*
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685*

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,368,170 L255F probably damaging Het
9130011E15Rik A T 19: 45,975,283 probably benign Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Atm T A 9: 53,479,748 D1842V probably benign Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccdc88a A G 11: 29,447,995 T243A possibly damaging Het
Col5a3 G T 9: 20,807,653 N268K unknown Het
Col6a1 G A 10: 76,711,320 T737M unknown Het
Cyp3a25 T C 5: 146,003,128 probably benign Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Ecm1 G T 3: 95,734,846 Q476K possibly damaging Het
Eml6 A G 11: 29,831,097 probably null Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm5478 A G 15: 101,644,303 Y398H probably damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hk1 T C 10: 62,296,019 probably null Het
Kdm6b A G 11: 69,406,366 Y387H probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lrig3 G A 10: 125,997,187 C310Y probably damaging Het
Map6 T A 7: 99,336,824 V645E probably damaging Het
Memo1 A T 17: 74,202,352 I224K probably damaging Het
Morc2a T C 11: 3,683,612 I602T probably benign Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Ndrg3 T A 2: 156,944,037 I161F probably damaging Het
Notch3 T C 17: 32,158,461 R214G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr116 T C 17: 37,624,236 E133G possibly damaging Het
Olfr1178 T C 2: 88,391,406 I53T probably benign Het
Pdgfra T C 5: 75,167,936 V243A probably damaging Het
Piwil4 A G 9: 14,700,248 probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pon2 A T 6: 5,266,986 N252K possibly damaging Het
Ptf1a T C 2: 19,445,907 F16S probably damaging Het
Rasgrp1 A G 2: 117,291,812 Y366H probably benign Het
Rbfox1 G A 16: 7,408,028 V353I possibly damaging Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf4 T A 16: 90,260,217 D82V unknown Het
Serhl C A 15: 83,104,403 P177Q probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Sf3b3 A G 8: 110,812,020 S1123P probably damaging Het
Slc1a3 T C 15: 8,639,123 I453V probably damaging Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Snrnp200 T A 2: 127,221,882 D660E probably damaging Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
Speer4e T A 5: 14,934,925 E206D possibly damaging Het
Stard6 T A 18: 70,500,486 M188K probably damaging Het
Stat6 G A 10: 127,652,222 V282I possibly damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Szt2 A C 4: 118,383,034 probably null Het
Thsd4 C A 9: 60,394,387 K208N probably benign Het
Thsd7b C T 1: 130,218,118 Q1588* probably null Het
Tmem167 C T 13: 90,104,380 R52C probably benign Het
Ttn T C 2: 76,899,409 probably benign Het
Usp39 G A 6: 72,338,389 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r24 C T 6: 123,779,025 Q19* probably null Het
Vps13b G A 15: 35,910,304 E3405K probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71167119 missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71194468 critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71164378 splice site probably null
IGL01835:2700049A03Rik APN 12 71167181 nonsense probably null
IGL01835:2700049A03Rik APN 12 71167183 missense probably benign 0.00
IGL02122:2700049A03Rik APN 12 71170525 missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71148260 missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71154856 missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71193373 missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71140883 missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71158825 splice site probably benign
G4846:2700049A03Rik UTSW 12 71137909 missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71160386 missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71170666 missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71177918 missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71167150 missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71148420 critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71138030 missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71193310 missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71164388 missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71177868 missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71158883 missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71219308 splice site probably benign
R1244:2700049A03Rik UTSW 12 71216144 missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71170587 unclassified probably null
R1599:2700049A03Rik UTSW 12 71150259 missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71219221 missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71150244 missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71160412 splice site probably null
R1998:2700049A03Rik UTSW 12 71188619 missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2337:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2340:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2382:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2384:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2445:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2449:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2512:2700049A03Rik UTSW 12 71173171 missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71154756 splice site probably benign
R3236:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3237:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3734:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3808:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3808:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3809:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3944:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3960:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4593:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4595:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4596:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71148263 missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4649:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4651:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4652:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4714:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4735:2700049A03Rik UTSW 12 71216123 missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71189442 missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4852:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4854:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4855:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4884:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4905:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71189646 missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4919:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4989:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5011:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5012:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5118:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71243025 missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5163:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5188:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5189:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71193349 missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5190:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71188791 missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71243027 missense probably benign
R5502:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5502:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5503:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5619:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5667:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5669:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5671:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71193319 missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71157119 missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71184530 missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71187426 missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71170636 missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71164544 missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71216230 intron probably null
R7168:2700049A03Rik UTSW 12 71216057 missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71219189 critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71140906 missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71189574 missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71150405 missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- ACACTGTTCCCTGGCAGATAAC -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TAACGGTACTGAAGCTCTGC -3'
Posted On2015-01-23