Incidental Mutation 'R0326:Cacna2d3'
ID25905
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 3
Synonymsalpha2delta3, alpha 2 delta-3
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location28904943-29721864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29045644 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 758 (E758V)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567]
Predicted Effect probably damaging
Transcript: ENSMUST00000022567
AA Change: E758V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: E758V

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29467949 missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28943555 critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28908321 missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7009:Cacna2d3 UTSW 14 28969365 start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
R7427:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 29058618 missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 29045544 splice site probably null
R7560:Cacna2d3 UTSW 14 29058421 missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 29043546 missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 29105038 splice site probably benign
R8096:Cacna2d3 UTSW 14 29103700 missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28982371 missense probably benign 0.25
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29347163 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATTCTGCACTGACTGAAGGCTGAC -3'
(R):5'- CCAGAACCCACAGGCACTTTTGAG -3'

Sequencing Primer
(F):5'- GGATGTGCACAAATTCCCAC -3'
(R):5'- CACAGGCACTTTTGAGTAAAGTCG -3'
Posted On2013-04-16