Incidental Mutation 'R3236:Vps13b'
ID 259055
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
MMRRC Submission 040618-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3236 (G1)
Quality Score 154
Status Validated
Chromosome 15
Chromosomal Location 35371306-35931375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35910450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 3405 (E3405K)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048646
AA Change: E3405K

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: E3405K

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Meta Mutation Damage Score 0.2490 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
5730455P16Rik G A 11: 80,258,996 (GRCm39) L255F probably damaging Het
Aff2 T A X: 68,907,543 (GRCm39) V1175E possibly damaging Het
Agbl3 A G 6: 34,800,022 (GRCm39) probably null Het
Armh3 A T 19: 45,963,722 (GRCm39) probably benign Het
Atm T A 9: 53,391,048 (GRCm39) D1842V probably benign Het
Bcar3 C A 3: 122,318,645 (GRCm39) Q678K probably benign Het
Ccdc88a A G 11: 29,397,995 (GRCm39) T243A possibly damaging Het
Col5a3 G T 9: 20,718,949 (GRCm39) N268K unknown Het
Col6a1 G A 10: 76,547,154 (GRCm39) T737M unknown Het
Cyp3a25 T C 5: 145,939,938 (GRCm39) probably benign Het
Dnah17 T C 11: 117,985,680 (GRCm39) T1466A probably benign Het
Dnah9 G A 11: 65,845,815 (GRCm39) T3023I probably benign Het
Ecm1 G T 3: 95,642,158 (GRCm39) Q476K possibly damaging Het
Eml6 A G 11: 29,781,097 (GRCm39) probably null Het
Fbh1 T C 2: 11,774,637 (GRCm39) D36G probably damaging Het
Fyb1 A C 15: 6,659,597 (GRCm39) D434A probably damaging Het
Gm5478 A G 15: 101,552,738 (GRCm39) Y398H probably damaging Het
H2-Q6 C A 17: 35,644,676 (GRCm39) T155K probably damaging Het
Hk1 T C 10: 62,131,798 (GRCm39) probably null Het
Kdm6b A G 11: 69,297,192 (GRCm39) Y387H probably damaging Het
Lipn A G 19: 34,046,138 (GRCm39) N37S probably benign Het
Lrig3 G A 10: 125,833,056 (GRCm39) C310Y probably damaging Het
Map6 T A 7: 98,986,031 (GRCm39) V645E probably damaging Het
Memo1 A T 17: 74,509,347 (GRCm39) I224K probably damaging Het
Morc2a T C 11: 3,633,612 (GRCm39) I602T probably benign Het
N4bp3 A T 11: 51,536,761 (GRCm39) F104Y probably damaging Het
Ndrg3 T A 2: 156,785,957 (GRCm39) I161F probably damaging Het
Notch3 T C 17: 32,377,435 (GRCm39) R214G probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or14j10 T C 17: 37,935,127 (GRCm39) E133G possibly damaging Het
Or4p7 T C 2: 88,221,750 (GRCm39) I53T probably benign Het
Pdgfra T C 5: 75,328,597 (GRCm39) V243A probably damaging Het
Piwil4 A G 9: 14,611,544 (GRCm39) probably benign Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pon2 A T 6: 5,266,986 (GRCm39) N252K possibly damaging Het
Ptf1a T C 2: 19,450,718 (GRCm39) F16S probably damaging Het
Rasgrp1 A G 2: 117,122,293 (GRCm39) Y366H probably benign Het
Rbfox1 G A 16: 7,225,892 (GRCm39) V353I possibly damaging Het
Rrh T C 3: 129,605,360 (GRCm39) Y110C probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scaf4 T A 16: 90,057,105 (GRCm39) D82V unknown Het
Serhl C A 15: 82,988,604 (GRCm39) P177Q probably damaging Het
Setdb1 A G 3: 95,246,065 (GRCm39) V619A probably damaging Het
Sf3b3 A G 8: 111,538,652 (GRCm39) S1123P probably damaging Het
Slc1a3 T C 15: 8,668,607 (GRCm39) I453V probably damaging Het
Slf2 A G 19: 44,930,773 (GRCm39) I617V probably benign Het
Snrnp200 T A 2: 127,063,802 (GRCm39) D660E probably damaging Het
Spata22 T A 11: 73,236,713 (GRCm39) F340I probably damaging Het
Speer4e1 T A 5: 14,984,939 (GRCm39) E206D possibly damaging Het
Stard6 T A 18: 70,633,557 (GRCm39) M188K probably damaging Het
Stat6 G A 10: 127,488,091 (GRCm39) V282I possibly damaging Het
Supt20 T C 3: 54,616,501 (GRCm39) S253P possibly damaging Het
Szt2 A C 4: 118,240,231 (GRCm39) probably null Het
Thsd4 C A 9: 60,301,670 (GRCm39) K208N probably benign Het
Thsd7b C T 1: 130,145,855 (GRCm39) Q1588* probably null Het
Tmem167 C T 13: 90,252,499 (GRCm39) R52C probably benign Het
Ttn T C 2: 76,729,753 (GRCm39) probably benign Het
Usp39 G A 6: 72,315,372 (GRCm39) probably benign Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Vmn2r24 C T 6: 123,755,984 (GRCm39) Q19* probably null Het
Zgrf1 A G 3: 127,407,024 (GRCm39) D1597G probably damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,372 (GRCm39) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,794,030 (GRCm39) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,703 (GRCm39) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,723 (GRCm39) missense probably benign
IGL00753:Vps13b APN 15 35,372,177 (GRCm39) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,847,046 (GRCm39) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,916 (GRCm39) splice site probably benign
IGL01349:Vps13b APN 15 35,794,091 (GRCm39) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,625 (GRCm39) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,455,103 (GRCm39) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,635 (GRCm39) splice site probably benign
IGL01642:Vps13b APN 15 35,792,218 (GRCm39) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,479 (GRCm39) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,935 (GRCm39) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,945 (GRCm39) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,993 (GRCm39) splice site probably benign
IGL01982:Vps13b APN 15 35,439,050 (GRCm39) nonsense probably null
IGL01997:Vps13b APN 15 35,709,370 (GRCm39) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,391 (GRCm39) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,732 (GRCm39) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,759 (GRCm39) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,227 (GRCm39) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,479 (GRCm39) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,202 (GRCm39) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,660 (GRCm39) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,887 (GRCm39) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,308 (GRCm39) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,242 (GRCm39) missense probably benign
IGL02553:Vps13b APN 15 35,646,447 (GRCm39) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,640,104 (GRCm39) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,288 (GRCm39) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,274 (GRCm39) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,880,046 (GRCm39) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,665 (GRCm39) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,966 (GRCm39) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,446 (GRCm39) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,316 (GRCm39) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,640,012 (GRCm39) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,486 (GRCm39) missense probably benign
omlette UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
swiss UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,971 (GRCm39) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,409 (GRCm39) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,386 (GRCm39) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,301 (GRCm39) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,674 (GRCm39) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,365 (GRCm39) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,472,045 (GRCm39) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,974 (GRCm39) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,949 (GRCm39) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,279 (GRCm39) nonsense probably null
R0463:Vps13b UTSW 15 35,597,555 (GRCm39) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,748 (GRCm39) nonsense probably null
R0472:Vps13b UTSW 15 35,417,779 (GRCm39) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,196 (GRCm39) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,514 (GRCm39) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,803 (GRCm39) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,372,145 (GRCm39) nonsense probably null
R0679:Vps13b UTSW 15 35,709,849 (GRCm39) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,507 (GRCm39) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,509 (GRCm39) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,600 (GRCm39) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,458 (GRCm39) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,268 (GRCm39) splice site probably benign
R1453:Vps13b UTSW 15 35,422,590 (GRCm39) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,719 (GRCm39) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,840,121 (GRCm39) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,876 (GRCm39) nonsense probably null
R1536:Vps13b UTSW 15 35,875,712 (GRCm39) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,327 (GRCm39) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,465 (GRCm39) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,582 (GRCm39) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R1695:Vps13b UTSW 15 35,576,667 (GRCm39) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,765 (GRCm39) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,351 (GRCm39) nonsense probably null
R1804:Vps13b UTSW 15 35,917,283 (GRCm39) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,205 (GRCm39) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,788 (GRCm39) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,723 (GRCm39) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,378 (GRCm39) missense probably damaging 0.99
R1850:Vps13b UTSW 15 35,675,105 (GRCm39) splice site probably benign
R1884:Vps13b UTSW 15 35,430,437 (GRCm39) splice site probably benign
R1938:Vps13b UTSW 15 35,709,653 (GRCm39) missense probably damaging 1.00
R1955:Vps13b UTSW 15 35,925,554 (GRCm39) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,553 (GRCm39) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,835 (GRCm39) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,887 (GRCm39) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,593 (GRCm39) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,892 (GRCm39) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,639 (GRCm39) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,226 (GRCm39) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,334 (GRCm39) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,335 (GRCm39) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,343 (GRCm39) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,743 (GRCm39) missense probably benign
R2263:Vps13b UTSW 15 35,646,327 (GRCm39) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,251 (GRCm39) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,675,045 (GRCm39) nonsense probably null
R2351:Vps13b UTSW 15 35,869,457 (GRCm39) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,701 (GRCm39) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,541 (GRCm39) missense probably damaging 1.00
R3404:Vps13b UTSW 15 35,926,200 (GRCm39) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,528 (GRCm39) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,274 (GRCm39) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,173 (GRCm39) splice site probably null
R4224:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,440 (GRCm39) missense probably damaging 0.98
R4431:Vps13b UTSW 15 35,770,899 (GRCm39) missense probably damaging 1.00
R4449:Vps13b UTSW 15 35,876,939 (GRCm39) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35,646,278 (GRCm39) missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35,770,835 (GRCm39) missense probably benign
R4666:Vps13b UTSW 15 35,640,690 (GRCm39) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,967 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,841,487 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,646,324 (GRCm39) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,864 (GRCm39) nonsense probably null
R4771:Vps13b UTSW 15 35,910,946 (GRCm39) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,370 (GRCm39) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,518 (GRCm39) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,439 (GRCm39) missense probably benign
R4857:Vps13b UTSW 15 35,456,800 (GRCm39) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,661 (GRCm39) splice site probably null
R5095:Vps13b UTSW 15 35,923,348 (GRCm39) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,955 (GRCm39) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,824 (GRCm39) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,599 (GRCm39) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,559 (GRCm39) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,674 (GRCm39) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,887,094 (GRCm39) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,531 (GRCm39) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5489:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5503:Vps13b UTSW 15 35,452,312 (GRCm39) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,930,065 (GRCm39) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,181 (GRCm39) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,497 (GRCm39) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,207 (GRCm39) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,918 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,462 (GRCm39) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,884 (GRCm39) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,177 (GRCm39) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,610 (GRCm39) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,272 (GRCm39) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,993 (GRCm39) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,247 (GRCm39) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,842 (GRCm39) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,451 (GRCm39) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,395 (GRCm39) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,829 (GRCm39) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,757 (GRCm39) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,736 (GRCm39) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,455 (GRCm39) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,541 (GRCm39) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,344 (GRCm39) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,835 (GRCm39) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,727 (GRCm39) missense probably benign 0.02
R7092:Vps13b UTSW 15 35,640,780 (GRCm39) missense probably damaging 1.00
R7232:Vps13b UTSW 15 35,877,703 (GRCm39) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,691 (GRCm39) missense probably benign
R7400:Vps13b UTSW 15 35,379,046 (GRCm39) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,973 (GRCm39) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,843 (GRCm39) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,670 (GRCm39) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,585 (GRCm39) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,792 (GRCm39) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,378 (GRCm39) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,880,059 (GRCm39) missense probably benign
R8094:Vps13b UTSW 15 35,669,052 (GRCm39) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,492 (GRCm39) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,255 (GRCm39) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R8174:Vps13b UTSW 15 35,709,456 (GRCm39) nonsense probably null
R8225:Vps13b UTSW 15 35,794,528 (GRCm39) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,550 (GRCm39) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,349 (GRCm39) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,640,063 (GRCm39) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,887,100 (GRCm39) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,246 (GRCm39) missense probably benign
R8494:Vps13b UTSW 15 35,422,594 (GRCm39) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,466 (GRCm39) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,891 (GRCm39) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,788 (GRCm39) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,535 (GRCm39) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,483 (GRCm39) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,212 (GRCm39) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,445 (GRCm39) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,470 (GRCm39) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,931 (GRCm39) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,537 (GRCm39) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,793 (GRCm39) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,892 (GRCm39) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,479 (GRCm39) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,925 (GRCm39) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,290 (GRCm39) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,847,059 (GRCm39) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,200 (GRCm39) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,880 (GRCm39) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,457 (GRCm39) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,774 (GRCm39) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,380 (GRCm39) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,675,033 (GRCm39) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,403 (GRCm39) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,675,022 (GRCm39) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,552 (GRCm39) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,792 (GRCm39) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,577 (GRCm39) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,669,031 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACACTAACAAGCTTTGCCC -3'
(R):5'- ATGTCCTTCCCCTCAGAGAC -3'

Sequencing Primer
(F):5'- AACAAGCTTTGCCCTTTCTCTAGAG -3'
(R):5'- CTTCCAAGGCTTTGCTGGAGAC -3'
Posted On 2015-01-23