Mutagenetix > Incidental Mutations

Incidental Mutation 'R0328:Vmn2r112'

25906

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r112

Ensembl Gene

ENSMUSG00000094921

Gene Name

vomeronasal 2, receptor 112

Synonyms

EG628185

MMRRC Submission

038537-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R0328 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22601148-22619133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22605270 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 502 (I502K)

Ref Sequence

ENSEMBL: ENSMUSP00000094994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097381]

Predicted Effect

probably benign
Transcript: ENSMUST00000097381
AA Change: I502K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: I502K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.8e-32	PFAM
Pfam:NCD3G	512	565	5.8e-21	PFAM
Pfam:7tm_3	598	833	6.5e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.5%
20x: 90.8%

Validation Efficiency

96% (46/48)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,744,280	H618L	possibly damaging	Het
Aacs	T	C	5: 125,516,259	V642A	probably benign	Het
Alms1	A	G	6: 85,610,814		probably null	Het
Arhgap39	A	G	15: 76,751,952		probably benign	Het
Bard1	C	T	1: 71,046,762	V595I	probably benign	Het
Bptf	T	C	11: 107,047,127	K2713E	probably damaging	Het
Calhm1	C	T	19: 47,141,303	G260D	possibly damaging	Het
Ccdc154	A	C	17: 25,171,805	K643T	probably benign	Het
Ccl4	T	A	11: 83,663,557	S59T	probably damaging	Het
Cntd1	T	C	11: 101,283,433	S73P	probably benign	Het
Colgalt2	A	T	1: 152,473,108	D168V	probably damaging	Het
Fam117a	T	C	11: 95,375,626		probably benign	Het
Fat1	A	G	8: 45,023,790	T1935A	probably benign	Het
Fbxw21	T	A	9: 109,146,585	I248F	possibly damaging	Het
Fhod3	A	T	18: 25,113,600	M1288L	probably benign	Het
Gm5114	T	G	7: 39,408,461	K578T	probably damaging	Het
Gxylt2	A	T	6: 100,750,535		probably benign	Het
Helz	G	T	11: 107,604,348	A383S	probably benign	Het
Ift172	C	A	5: 31,263,851	E968*	probably null	Het
Itpripl1	T	C	2: 127,142,004	N66S	possibly damaging	Het
Kcnma1	A	G	14: 23,373,197	Y686H	probably damaging	Het
Ndrg1	C	A	15: 66,943,159		probably benign	Het
Ogdh	T	C	11: 6,347,216	V545A	probably benign	Het
Olfr121	A	G	17: 37,752,393	I180V	possibly damaging	Het
P3h3	G	A	6: 124,854,306		probably benign	Het
Ppme1	A	T	7: 100,333,975		probably null	Het
Prkag1	T	G	15: 98,815,682	D44A	probably damaging	Het
Prpf39	T	C	12: 65,043,371		probably benign	Het
Rabep1	C	A	11: 70,919,207	R489S	probably damaging	Het
Scn10a	A	G	9: 119,694,102	V75A	possibly damaging	Het
Sema3d	T	C	5: 12,448,075	L16P	possibly damaging	Het
Skida1	T	C	2: 18,047,186		probably benign	Het
Sptbn4	T	C	7: 27,364,170	Y2277C	probably damaging	Het
Syne1	A	G	10: 5,348,945	I1047T	possibly damaging	Het
Syt17	A	G	7: 118,381,993	Y369H	probably benign	Het
Tmem131l	C	T	3: 83,921,931		probably benign	Het
Traf3ip2	A	T	10: 39,634,673	D314V	probably damaging	Het
Ttc28	T	G	5: 111,284,067		probably benign	Het
Ush1c	A	C	7: 46,225,448		probably benign	Het
Utp20	A	T	10: 88,767,107	Y1884N	possibly damaging	Het
Vmn2r60	T	C	7: 42,142,320		probably benign	Het
Vmn2r63	T	C	7: 42,903,275	I852M	probably benign	Het
Vmn2r9	T	A	5: 108,847,539	E414D	probably benign	Het
Wnt4	A	G	4: 137,295,443	T106A	probably damaging	Het
Zbtb26	A	T	2: 37,436,795	N76K	possibly damaging	Het
Zfhx2	T	C	14: 55,071,988	T885A	probably benign	Het

Other mutations in Vmn2r112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Vmn2r112	APN	17	22618936	missense	probably benign	0.13
IGL01021:Vmn2r112	APN	17	22618904	missense	probably damaging	1.00
IGL01122:Vmn2r112	APN	17	22603007	missense	probably benign	0.00
IGL01360:Vmn2r112	APN	17	22618622	missense	probably benign	0.03
IGL01536:Vmn2r112	APN	17	22605155	missense	probably damaging	1.00
IGL02148:Vmn2r112	APN	17	22619032	missense	probably damaging	1.00
IGL02465:Vmn2r112	APN	17	22614994	missense	probably damaging	1.00
PIT4576001:Vmn2r112	UTSW	17	22614931	missense	probably benign	0.00
R0278:Vmn2r112	UTSW	17	22603006	missense	probably benign	0.44
R0583:Vmn2r112	UTSW	17	22618949	missense	probably damaging	1.00
R0831:Vmn2r112	UTSW	17	22614999	missense	probably damaging	0.99
R1080:Vmn2r112	UTSW	17	22618999	missense	probably damaging	1.00
R1245:Vmn2r112	UTSW	17	22603247	missense	probably benign	0.03
R1321:Vmn2r112	UTSW	17	22618519	nonsense	probably null
R1381:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R1514:Vmn2r112	UTSW	17	22602844	missense	probably benign	0.40
R1519:Vmn2r112	UTSW	17	22618903	missense	possibly damaging	0.83
R1572:Vmn2r112	UTSW	17	22603144	missense	possibly damaging	0.61
R1590:Vmn2r112	UTSW	17	22615008	critical splice donor site	probably null
R1640:Vmn2r112	UTSW	17	22605116	missense	probably benign	0.01
R2221:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2223:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2310:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2312:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2337:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2339:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2340:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2341:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2342:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2401:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2860:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2861:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2926:Vmn2r112	UTSW	17	22615003	missense	possibly damaging	0.90
R3236:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3237:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3977:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3979:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R4168:Vmn2r112	UTSW	17	22603088	missense	probably benign	0.01
R4256:Vmn2r112	UTSW	17	22618412	missense	probably damaging	1.00
R4386:Vmn2r112	UTSW	17	22601322	missense	probably benign	0.36
R4912:Vmn2r112	UTSW	17	22603382	missense	probably damaging	0.99
R4947:Vmn2r112	UTSW	17	22602879	missense	probably benign	0.02
R5446:Vmn2r112	UTSW	17	22618250	missense	probably damaging	1.00
R5870:Vmn2r112	UTSW	17	22619023	missense	probably benign	0.00
R6351:Vmn2r112	UTSW	17	22601278	missense	probably benign
R6384:Vmn2r112	UTSW	17	22605155	missense	probably damaging	1.00
R6390:Vmn2r112	UTSW	17	22605249	missense	probably benign	0.01
R6401:Vmn2r112	UTSW	17	22603551	nonsense	probably null
R6405:Vmn2r112	UTSW	17	22618235	missense	probably damaging	1.00
R6620:Vmn2r112	UTSW	17	22603101	missense	probably benign	0.00
R6648:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R6649:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6653:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6654:Vmn2r112	UTSW	17	22603469	missense	possibly damaging	0.89
R6700:Vmn2r112	UTSW	17	22603481	missense	possibly damaging	0.53
R6993:Vmn2r112	UTSW	17	22603214	missense	probably benign	0.01
R7052:Vmn2r112	UTSW	17	22602526	missense	probably benign
R7454:Vmn2r112	UTSW	17	22603307	missense	probably benign	0.00
R7763:Vmn2r112	UTSW	17	22603118	missense	probably damaging	1.00
R8032:Vmn2r112	UTSW	17	22603394	missense	probably benign	0.21
R8177:Vmn2r112	UTSW	17	22603613	missense	possibly damaging	0.47
R8263:Vmn2r112	UTSW	17	22605159	missense	probably damaging	1.00
R8395:Vmn2r112	UTSW	17	22618606	missense	possibly damaging	0.94
R8492:Vmn2r112	UTSW	17	22602489	missense	probably benign	0.03
Z1088:Vmn2r112	UTSW	17	22605078	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGGATTCCTCTCTGAGAAAGACACAGT -3'
(R):5'- GTGTATTCATGTTGGAAACCCTCAGTGA -3'

Sequencing Primer
(F):5'- ACACAGTTCACTAATCCTGTTGGG -3'
(R):5'- GTTGGAAACCCTCAGTGAATTAC -3'

Posted On

2013-04-16