Incidental Mutation 'R3236:Olfr116'
ID259065
Institutional Source Beutler Lab
Gene Symbol Olfr116
Ensembl Gene ENSMUSG00000061336
Gene Nameolfactory receptor 116
SynonymsMOR218-2, GA_x6K02T2PSCP-2084102-2083137
MMRRC Submission 040618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3236 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37620577-37627199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37624236 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 133 (E133G)
Ref Sequence ENSEMBL: ENSMUSP00000150977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072265] [ENSMUST00000216128] [ENSMUST00000223366]
Predicted Effect probably benign
Transcript: ENSMUST00000072265
AA Change: E133G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000072115
Gene: ENSMUSG00000061336
AA Change: E133G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 6.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216128
AA Change: E133G

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000223366
Meta Mutation Damage Score 0.3150 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
5730455P16Rik G A 11: 80,368,170 L255F probably damaging Het
9130011E15Rik A T 19: 45,975,283 probably benign Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Atm T A 9: 53,479,748 D1842V probably benign Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccdc88a A G 11: 29,447,995 T243A possibly damaging Het
Col5a3 G T 9: 20,807,653 N268K unknown Het
Col6a1 G A 10: 76,711,320 T737M unknown Het
Cyp3a25 T C 5: 146,003,128 probably benign Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Ecm1 G T 3: 95,734,846 Q476K possibly damaging Het
Eml6 A G 11: 29,831,097 probably null Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm5478 A G 15: 101,644,303 Y398H probably damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hk1 T C 10: 62,296,019 probably null Het
Kdm6b A G 11: 69,406,366 Y387H probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lrig3 G A 10: 125,997,187 C310Y probably damaging Het
Map6 T A 7: 99,336,824 V645E probably damaging Het
Memo1 A T 17: 74,202,352 I224K probably damaging Het
Morc2a T C 11: 3,683,612 I602T probably benign Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Ndrg3 T A 2: 156,944,037 I161F probably damaging Het
Notch3 T C 17: 32,158,461 R214G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1178 T C 2: 88,391,406 I53T probably benign Het
Pdgfra T C 5: 75,167,936 V243A probably damaging Het
Piwil4 A G 9: 14,700,248 probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pon2 A T 6: 5,266,986 N252K possibly damaging Het
Ptf1a T C 2: 19,445,907 F16S probably damaging Het
Rasgrp1 A G 2: 117,291,812 Y366H probably benign Het
Rbfox1 G A 16: 7,408,028 V353I possibly damaging Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf4 T A 16: 90,260,217 D82V unknown Het
Serhl C A 15: 83,104,403 P177Q probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Sf3b3 A G 8: 110,812,020 S1123P probably damaging Het
Slc1a3 T C 15: 8,639,123 I453V probably damaging Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Snrnp200 T A 2: 127,221,882 D660E probably damaging Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
Speer4e T A 5: 14,934,925 E206D possibly damaging Het
Stard6 T A 18: 70,500,486 M188K probably damaging Het
Stat6 G A 10: 127,652,222 V282I possibly damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Szt2 A C 4: 118,383,034 probably null Het
Thsd4 C A 9: 60,394,387 K208N probably benign Het
Thsd7b C T 1: 130,218,118 Q1588* probably null Het
Tmem167 C T 13: 90,104,380 R52C probably benign Het
Ttn T C 2: 76,899,409 probably benign Het
Usp39 G A 6: 72,338,389 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r24 C T 6: 123,779,025 Q19* probably null Het
Vps13b G A 15: 35,910,304 E3405K probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Olfr116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Olfr116 APN 17 37624576 missense possibly damaging 0.86
IGL02639:Olfr116 APN 17 37623987 missense probably benign 0.01
IGL02663:Olfr116 APN 17 37624044 missense probably benign 0.37
R0049:Olfr116 UTSW 17 37624133 missense probably benign 0.02
R1260:Olfr116 UTSW 17 37623703 missense probably benign 0.00
R1531:Olfr116 UTSW 17 37624352 nonsense probably null
R4083:Olfr116 UTSW 17 37624425 missense probably damaging 1.00
R4308:Olfr116 UTSW 17 37623736 missense possibly damaging 0.46
R4887:Olfr116 UTSW 17 37623891 missense probably damaging 0.99
R5167:Olfr116 UTSW 17 37623751 nonsense probably null
R5323:Olfr116 UTSW 17 37624155 missense probably benign 0.22
R5496:Olfr116 UTSW 17 37624578 missense probably benign 0.01
R5530:Olfr116 UTSW 17 37623807 missense possibly damaging 0.72
R5643:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5644:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5798:Olfr116 UTSW 17 37623990 missense probably benign 0.01
R6020:Olfr116 UTSW 17 37623967 missense possibly damaging 0.94
R7058:Olfr116 UTSW 17 37623706 missense probably benign 0.00
R7453:Olfr116 UTSW 17 37624385 missense probably benign 0.00
R7474:Olfr116 UTSW 17 37624386 missense probably benign 0.30
R7565:Olfr116 UTSW 17 37624501 missense probably damaging 0.99
R7646:Olfr116 UTSW 17 37624404 missense probably damaging 1.00
Z1088:Olfr116 UTSW 17 37624429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGACAGCTTGAGCAACTG -3'
(R):5'- CACAGCTCCAGTCTCCAATG -3'

Sequencing Primer
(F):5'- CTTGAGCAACTGGGGAACATCAC -3'
(R):5'- ACAGCTCCAGTCTCCAATGTATTAC -3'
Posted On2015-01-23