Incidental Mutation 'R3236:9130011E15Rik'
ID259071
Institutional Source Beutler Lab
Gene Symbol 9130011E15Rik
Ensembl Gene ENSMUSG00000039901
Gene NameRIKEN cDNA 9130011E15 gene
Synonyms
MMRRC Submission 040618-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3236 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45818144-45998488 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 45975283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045396]
Predicted Effect probably benign
Transcript: ENSMUST00000045396
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
5730455P16Rik G A 11: 80,368,170 L255F probably damaging Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Atm T A 9: 53,479,748 D1842V probably benign Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccdc88a A G 11: 29,447,995 T243A possibly damaging Het
Col5a3 G T 9: 20,807,653 N268K unknown Het
Col6a1 G A 10: 76,711,320 T737M unknown Het
Cyp3a25 T C 5: 146,003,128 probably benign Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Ecm1 G T 3: 95,734,846 Q476K possibly damaging Het
Eml6 A G 11: 29,831,097 probably null Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm5478 A G 15: 101,644,303 Y398H probably damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hk1 T C 10: 62,296,019 probably null Het
Kdm6b A G 11: 69,406,366 Y387H probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lrig3 G A 10: 125,997,187 C310Y probably damaging Het
Map6 T A 7: 99,336,824 V645E probably damaging Het
Memo1 A T 17: 74,202,352 I224K probably damaging Het
Morc2a T C 11: 3,683,612 I602T probably benign Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Ndrg3 T A 2: 156,944,037 I161F probably damaging Het
Notch3 T C 17: 32,158,461 R214G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr116 T C 17: 37,624,236 E133G possibly damaging Het
Olfr1178 T C 2: 88,391,406 I53T probably benign Het
Pdgfra T C 5: 75,167,936 V243A probably damaging Het
Piwil4 A G 9: 14,700,248 probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pon2 A T 6: 5,266,986 N252K possibly damaging Het
Ptf1a T C 2: 19,445,907 F16S probably damaging Het
Rasgrp1 A G 2: 117,291,812 Y366H probably benign Het
Rbfox1 G A 16: 7,408,028 V353I possibly damaging Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf4 T A 16: 90,260,217 D82V unknown Het
Serhl C A 15: 83,104,403 P177Q probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Sf3b3 A G 8: 110,812,020 S1123P probably damaging Het
Slc1a3 T C 15: 8,639,123 I453V probably damaging Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Snrnp200 T A 2: 127,221,882 D660E probably damaging Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
Speer4e T A 5: 14,934,925 E206D possibly damaging Het
Stard6 T A 18: 70,500,486 M188K probably damaging Het
Stat6 G A 10: 127,652,222 V282I possibly damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Szt2 A C 4: 118,383,034 probably null Het
Thsd4 C A 9: 60,394,387 K208N probably benign Het
Thsd7b C T 1: 130,218,118 Q1588* probably null Het
Tmem167 C T 13: 90,104,380 R52C probably benign Het
Ttn T C 2: 76,899,409 probably benign Het
Usp39 G A 6: 72,338,389 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r24 C T 6: 123,779,025 Q19* probably null Het
Vps13b G A 15: 35,910,304 E3405K probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in 9130011E15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:9130011E15Rik APN 19 45940488 missense probably benign 0.19
IGL00788:9130011E15Rik APN 19 45932350 critical splice donor site probably null
IGL01356:9130011E15Rik APN 19 45966303 missense possibly damaging 0.94
IGL01477:9130011E15Rik APN 19 45978604 missense probably damaging 0.99
IGL01660:9130011E15Rik APN 19 45940476 missense probably damaging 1.00
IGL02193:9130011E15Rik APN 19 45972884 missense probably benign 0.02
IGL02863:9130011E15Rik APN 19 45958411 missense probably damaging 1.00
IGL03108:9130011E15Rik APN 19 45820353 missense probably damaging 0.99
R0035:9130011E15Rik UTSW 19 45891240 missense probably damaging 1.00
R0791:9130011E15Rik UTSW 19 45933868 splice site probably null
R0792:9130011E15Rik UTSW 19 45933868 splice site probably null
R1487:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R1843:9130011E15Rik UTSW 19 45975252 missense probably benign 0.17
R2061:9130011E15Rik UTSW 19 45978667 missense probably damaging 1.00
R2070:9130011E15Rik UTSW 19 45891285 missense probably damaging 1.00
R2072:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2073:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2074:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2091:9130011E15Rik UTSW 19 45952680 missense probably damaging 1.00
R2263:9130011E15Rik UTSW 19 45932349 critical splice donor site probably null
R2863:9130011E15Rik UTSW 19 45885957 missense probably damaging 1.00
R3796:9130011E15Rik UTSW 19 45921610 splice site probably benign
R4044:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R4716:9130011E15Rik UTSW 19 45960342 missense probably damaging 1.00
R4974:9130011E15Rik UTSW 19 45820287 missense probably damaging 1.00
R4983:9130011E15Rik UTSW 19 45950707 missense probably benign
R5063:9130011E15Rik UTSW 19 45885955 missense possibly damaging 0.95
R5313:9130011E15Rik UTSW 19 45818975 missense probably damaging 1.00
R5782:9130011E15Rik UTSW 19 45886027 missense probably benign 0.08
R5985:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R6220:9130011E15Rik UTSW 19 45846115 missense possibly damaging 0.79
R6379:9130011E15Rik UTSW 19 45921697 missense possibly damaging 0.46
R6674:9130011E15Rik UTSW 19 45974998 missense probably benign 0.06
R6842:9130011E15Rik UTSW 19 45818977 missense probably benign 0.05
R6890:9130011E15Rik UTSW 19 45960357 missense probably damaging 1.00
R7034:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7036:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7305:9130011E15Rik UTSW 19 45892121 missense probably benign 0.35
R7411:9130011E15Rik UTSW 19 45965435 missense probably benign 0.00
R7762:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R8021:9130011E15Rik UTSW 19 45956741 critical splice acceptor site probably null
R8366:9130011E15Rik UTSW 19 45932354 missense probably damaging 1.00
X0060:9130011E15Rik UTSW 19 45932393 missense possibly damaging 0.95
Z1088:9130011E15Rik UTSW 19 45818905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAGGGACTCTAGCTTGC -3'
(R):5'- AGCCATGTTTTACTTTCAGTGTAGG -3'

Sequencing Primer
(F):5'- GGGACTCTAGCTTGCCTTCCAG -3'
(R):5'- AGGGAATATATATCCATACACTGCC -3'
Posted On2015-01-23