Incidental Mutation 'R3237:Optn'
ID259076
Institutional Source Beutler Lab
Gene Symbol Optn
Ensembl Gene ENSMUSG00000026672
Gene Nameoptineurin
SynonymsTFIIIA-INTP, 4930441O07Rik
MMRRC Submission 040619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3237 (G1)
Quality Score168
Status Not validated
Chromosome2
Chromosomal Location5020642-5064051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5034203 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 370 (S370G)
Ref Sequence ENSEMBL: ENSMUSP00000110648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027986] [ENSMUST00000114996]
Predicted Effect probably damaging
Transcript: ENSMUST00000027986
AA Change: S370G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027986
Gene: ENSMUSG00000026672
AA Change: S370G

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
PDB:2ZVO|D 424 512 2e-11 PDB
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114996
AA Change: S370G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110648
Gene: ENSMUSG00000026672
AA Change: S370G

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
Pfam:CC2-LZ 407 510 3.2e-33 PFAM
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145585
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice hypomorphic allele exhibit background sensitive embryonic lethality with surviving mice exhibiting normal immune cell development, T and B cell activation and TNF- or LPS-mediated activation of cells of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccm2 G A 11: 6,570,090 V53I probably benign Het
Cd3e G T 9: 45,002,310 C42* probably null Het
Cd4 A T 6: 124,867,670 I384N probably benign Het
Ceacam11 T A 7: 17,973,454 F54L probably benign Het
Cfap46 A G 7: 139,617,590 S2122P probably damaging Het
Clptm1 A G 7: 19,635,346 S461P probably damaging Het
Dlat T C 9: 50,638,031 T518A possibly damaging Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Fam181a T G 12: 103,316,089 C84W possibly damaging Het
Fam198a C T 9: 121,964,869 P30S possibly damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Inpp5b A G 4: 124,780,486 R329G probably benign Het
Klrb1f A T 6: 129,054,343 I168L possibly damaging Het
Lama4 A T 10: 39,097,179 I1581F probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lyzl4 T C 9: 121,584,167 D65G probably benign Het
Med29 A G 7: 28,392,621 probably benign Het
Myrip C A 9: 120,441,407 D574E possibly damaging Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Nlrp9a A T 7: 26,571,385 K892* probably null Het
Nsd1 T A 13: 55,312,888 H2309Q possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pbrm1 T C 14: 31,032,475 F151L probably damaging Het
Plekhs1 A T 19: 56,464,600 probably null Het
Rpn1 A G 6: 88,103,414 K565R probably benign Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr1 C T 7: 29,069,650 probably null Het
Scai C T 2: 39,150,314 probably benign Het
Scap C G 9: 110,379,582 P564A probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Slc41a3 T C 6: 90,636,865 Y226H probably benign Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Sned1 G A 1: 93,259,003 R180Q probably benign Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
St8sia3 T C 18: 64,269,815 F175S probably damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Syngap1 T A 17: 26,957,093 Y118* probably null Het
Szt2 A C 4: 118,383,034 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba3 G T 6: 97,186,240 T319K probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zc3hav1 A G 6: 38,319,715 L751S probably damaging Het
Zfp804b T C 5: 6,769,239 M1275V probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Optn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Optn APN 2 5033156 missense possibly damaging 0.93
IGL01433:Optn APN 2 5027144 missense probably benign 0.07
IGL01480:Optn APN 2 5046018 missense probably benign 0.01
IGL01863:Optn APN 2 5021487 splice site probably benign
IGL02108:Optn APN 2 5031273 missense possibly damaging 0.91
IGL02150:Optn APN 2 5033152 missense probably damaging 0.97
IGL02623:Optn APN 2 5035022 missense probably damaging 1.00
R0119:Optn UTSW 2 5024115 missense probably damaging 1.00
R0121:Optn UTSW 2 5024115 missense probably damaging 1.00
R0330:Optn UTSW 2 5034255 missense possibly damaging 0.53
R0332:Optn UTSW 2 5024115 missense probably damaging 1.00
R0335:Optn UTSW 2 5024115 missense probably damaging 1.00
R0390:Optn UTSW 2 5046195 missense probably benign
R0437:Optn UTSW 2 5024115 missense probably damaging 1.00
R1710:Optn UTSW 2 5053130 missense possibly damaging 0.90
R2229:Optn UTSW 2 5024117 missense probably damaging 1.00
R3740:Optn UTSW 2 5034198 missense possibly damaging 0.51
R3741:Optn UTSW 2 5034198 missense possibly damaging 0.51
R4667:Optn UTSW 2 5033139 missense probably benign 0.20
R4783:Optn UTSW 2 5054627 missense probably benign
R4965:Optn UTSW 2 5021379 missense probably benign 0.14
R5121:Optn UTSW 2 5046106 missense probably benign 0.25
R6119:Optn UTSW 2 5021323 splice site probably null
R7024:Optn UTSW 2 5052837 splice site probably null
R7167:Optn UTSW 2 5042483 missense probably benign 0.00
R7685:Optn UTSW 2 5054650 missense probably benign 0.01
R8103:Optn UTSW 2 5040202 missense probably damaging 0.97
R8267:Optn UTSW 2 5054651 missense probably benign 0.00
R8844:Optn UTSW 2 5027112 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCCTAGACATCTAGTTTCCAGATGG -3'
(R):5'- TTTGTGCAGAAGCCAGGGAG -3'

Sequencing Primer
(F):5'- AGATTTTATGCCATGACTCCCAGG -3'
(R):5'- CCAGGGAGAGTGACAAAGTGTTG -3'
Posted On2015-01-23