Mutagenetix > Incidental Mutation

Incidental Mutation 'R3237:Szt2'

259082

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

040619-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R3237 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 118383034 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406] [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075406

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000075406

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aff2	T	A	X: 69,863,937	V1175E	possibly damaging	Het
Agbl3	A	G	6: 34,823,087		probably null	Het
Bcar3	C	A	3: 122,524,996	Q678K	probably benign	Het
Ccm2	G	A	11: 6,570,090	V53I	probably benign	Het
Cd3e	G	T	9: 45,002,310	C42*	probably null	Het
Cd4	A	T	6: 124,867,670	I384N	probably benign	Het
Ceacam11	T	A	7: 17,973,454	F54L	probably benign	Het
Cfap46	A	G	7: 139,617,590	S2122P	probably damaging	Het
Clptm1	A	G	7: 19,635,346	S461P	probably damaging	Het
Dlat	T	C	9: 50,638,031	T518A	possibly damaging	Het
Dnah17	T	C	11: 118,094,854	T1466A	probably benign	Het
Dnah9	G	A	11: 65,954,989	T3023I	probably benign	Het
Fam181a	T	G	12: 103,316,089	C84W	possibly damaging	Het
Fam198a	C	T	9: 121,964,869	P30S	possibly damaging	Het
H2-Q6	C	A	17: 35,425,700	T155K	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Inpp5b	A	G	4: 124,780,486	R329G	probably benign	Het
Klrb1f	A	T	6: 129,054,343	I168L	possibly damaging	Het
Lama4	A	T	10: 39,097,179	I1581F	probably damaging	Het
Lipn	A	G	19: 34,068,738	N37S	probably benign	Het
Lyzl4	T	C	9: 121,584,167	D65G	probably benign	Het
Med29	A	G	7: 28,392,621		probably benign	Het
Myrip	C	A	9: 120,441,407	D574E	possibly damaging	Het
N4bp3	A	T	11: 51,645,934	F104Y	probably damaging	Het
Nlrp9a	A	T	7: 26,571,385	K892*	probably null	Het
Nsd1	T	A	13: 55,312,888	H2309Q	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Optn	T	C	2: 5,034,203	S370G	probably damaging	Het
Pbrm1	T	C	14: 31,032,475	F151L	probably damaging	Het
Plekhs1	A	T	19: 56,464,600		probably null	Het
Rpn1	A	G	6: 88,103,414	K565R	probably benign	Het
Rrh	T	C	3: 129,811,711	Y110C	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr1	C	T	7: 29,069,650		probably null	Het
Scai	C	T	2: 39,150,314		probably benign	Het
Scap	C	G	9: 110,379,582	P564A	probably damaging	Het
Setdb1	A	G	3: 95,338,754	V619A	probably damaging	Het
Slc41a3	T	C	6: 90,636,865	Y226H	probably benign	Het
Slf2	A	G	19: 44,942,334	I617V	probably benign	Het
Sned1	G	A	1: 93,259,003	R180Q	probably benign	Het
Spata22	T	A	11: 73,345,887	F340I	probably damaging	Het
St8sia3	T	C	18: 64,269,815	F175S	probably damaging	Het
Supt20	T	C	3: 54,709,080	S253P	possibly damaging	Het
Syngap1	T	A	17: 26,957,093	Y118*	probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Uba3	G	T	6: 97,186,240	T319K	probably damaging	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zc3hav1	A	G	6: 38,319,715	L751S	probably damaging	Het
Zfp804b	T	C	5: 6,769,239	M1275V	probably benign	Het
Zgrf1	A	G	3: 127,613,375	D1597G	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCAACCTCACCCTTAGCTG -3'
(R):5'- CTCGCTAGAGGATTCTGAAGGC -3'

Sequencing Primer
(F):5'- TTAGCTGAGGCCAAGTCATC -3'
(R):5'- TAGAGGATTCTGAAGGCACCCC -3'

Posted On

2015-01-23