Incidental Mutation 'R3237:Szt2'
ID 259082
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 040619-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R3237 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 118240231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406] [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Aff2 T A X: 68,907,543 (GRCm39) V1175E possibly damaging Het
Agbl3 A G 6: 34,800,022 (GRCm39) probably null Het
Bcar3 C A 3: 122,318,645 (GRCm39) Q678K probably benign Het
Ccm2 G A 11: 6,520,090 (GRCm39) V53I probably benign Het
Cd3e G T 9: 44,913,608 (GRCm39) C42* probably null Het
Cd4 A T 6: 124,844,633 (GRCm39) I384N probably benign Het
Ceacam11 T A 7: 17,707,379 (GRCm39) F54L probably benign Het
Cfap46 A G 7: 139,197,506 (GRCm39) S2122P probably damaging Het
Clptm1 A G 7: 19,369,271 (GRCm39) S461P probably damaging Het
Dlat T C 9: 50,549,331 (GRCm39) T518A possibly damaging Het
Dnah17 T C 11: 117,985,680 (GRCm39) T1466A probably benign Het
Dnah9 G A 11: 65,845,815 (GRCm39) T3023I probably benign Het
Fam181a T G 12: 103,282,348 (GRCm39) C84W possibly damaging Het
Gask1a C T 9: 121,793,935 (GRCm39) P30S possibly damaging Het
H2-Q6 C A 17: 35,644,676 (GRCm39) T155K probably damaging Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Inpp5b A G 4: 124,674,279 (GRCm39) R329G probably benign Het
Klrb1f A T 6: 129,031,306 (GRCm39) I168L possibly damaging Het
Lama4 A T 10: 38,973,175 (GRCm39) I1581F probably damaging Het
Lipn A G 19: 34,046,138 (GRCm39) N37S probably benign Het
Lyzl4 T C 9: 121,413,233 (GRCm39) D65G probably benign Het
Med29 A G 7: 28,092,046 (GRCm39) probably benign Het
Myrip C A 9: 120,270,473 (GRCm39) D574E possibly damaging Het
N4bp3 A T 11: 51,536,761 (GRCm39) F104Y probably damaging Het
Nlrp9a A T 7: 26,270,810 (GRCm39) K892* probably null Het
Nsd1 T A 13: 55,460,701 (GRCm39) H2309Q possibly damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Optn T C 2: 5,039,014 (GRCm39) S370G probably damaging Het
Pbrm1 T C 14: 30,754,432 (GRCm39) F151L probably damaging Het
Plekhs1 A T 19: 56,453,032 (GRCm39) probably null Het
Rpn1 A G 6: 88,080,396 (GRCm39) K565R probably benign Het
Rrh T C 3: 129,605,360 (GRCm39) Y110C probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryr1 C T 7: 28,769,075 (GRCm39) probably null Het
Scai C T 2: 39,040,326 (GRCm39) probably benign Het
Scap C G 9: 110,208,650 (GRCm39) P564A probably damaging Het
Setdb1 A G 3: 95,246,065 (GRCm39) V619A probably damaging Het
Slc41a3 T C 6: 90,613,847 (GRCm39) Y226H probably benign Het
Slf2 A G 19: 44,930,773 (GRCm39) I617V probably benign Het
Sned1 G A 1: 93,186,725 (GRCm39) R180Q probably benign Het
Spata22 T A 11: 73,236,713 (GRCm39) F340I probably damaging Het
St8sia3 T C 18: 64,402,886 (GRCm39) F175S probably damaging Het
Supt20 T C 3: 54,616,501 (GRCm39) S253P possibly damaging Het
Syngap1 T A 17: 27,176,067 (GRCm39) Y118* probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Uba3 G T 6: 97,163,201 (GRCm39) T319K probably damaging Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Zc3hav1 A G 6: 38,296,650 (GRCm39) L751S probably damaging Het
Zfp804b T C 5: 6,819,239 (GRCm39) M1275V probably benign Het
Zgrf1 A G 3: 127,407,024 (GRCm39) D1597G probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAACCTCACCCTTAGCTG -3'
(R):5'- CTCGCTAGAGGATTCTGAAGGC -3'

Sequencing Primer
(F):5'- TTAGCTGAGGCCAAGTCATC -3'
(R):5'- TAGAGGATTCTGAAGGCACCCC -3'
Posted On 2015-01-23