Incidental Mutation 'R3237:Agbl3'
ID259085
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene NameATP/GTP binding protein-like 3
Synonyms4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission 040619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3237 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34780432-34859459 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 34823087 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115016] [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000115017] [ENSMUST00000115017] [ENSMUST00000148834] [ENSMUST00000148834] [ENSMUST00000148834]
Predicted Effect probably null
Transcript: ENSMUST00000115016
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115016
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115016
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115017
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115017
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115017
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118782
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202017
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccm2 G A 11: 6,570,090 V53I probably benign Het
Cd3e G T 9: 45,002,310 C42* probably null Het
Cd4 A T 6: 124,867,670 I384N probably benign Het
Ceacam11 T A 7: 17,973,454 F54L probably benign Het
Cfap46 A G 7: 139,617,590 S2122P probably damaging Het
Clptm1 A G 7: 19,635,346 S461P probably damaging Het
Dlat T C 9: 50,638,031 T518A possibly damaging Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Fam181a T G 12: 103,316,089 C84W possibly damaging Het
Fam198a C T 9: 121,964,869 P30S possibly damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Inpp5b A G 4: 124,780,486 R329G probably benign Het
Klrb1f A T 6: 129,054,343 I168L possibly damaging Het
Lama4 A T 10: 39,097,179 I1581F probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lyzl4 T C 9: 121,584,167 D65G probably benign Het
Med29 A G 7: 28,392,621 probably benign Het
Myrip C A 9: 120,441,407 D574E possibly damaging Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Nlrp9a A T 7: 26,571,385 K892* probably null Het
Nsd1 T A 13: 55,312,888 H2309Q possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Optn T C 2: 5,034,203 S370G probably damaging Het
Pbrm1 T C 14: 31,032,475 F151L probably damaging Het
Plekhs1 A T 19: 56,464,600 probably null Het
Rpn1 A G 6: 88,103,414 K565R probably benign Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr1 C T 7: 29,069,650 probably null Het
Scai C T 2: 39,150,314 probably benign Het
Scap C G 9: 110,379,582 P564A probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Slc41a3 T C 6: 90,636,865 Y226H probably benign Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Sned1 G A 1: 93,259,003 R180Q probably benign Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
St8sia3 T C 18: 64,269,815 F175S probably damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Syngap1 T A 17: 26,957,093 Y118* probably null Het
Szt2 A C 4: 118,383,034 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba3 G T 6: 97,186,240 T319K probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zc3hav1 A G 6: 38,319,715 L751S probably damaging Het
Zfp804b T C 5: 6,769,239 M1275V probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TTCTAAATTGTCTGAGGCCACC -3'
(R):5'- ACAAGTGAGGTAAATTAGGTCACC -3'

Sequencing Primer
(F):5'- TGTCTGAGGCCACCAAATAATAAAG -3'
(R):5'- GGTCACCATATCTGACATTAACAAG -3'
Posted On2015-01-23