Incidental Mutation 'R0326:Dab2'
ID25909
Institutional Source Beutler Lab
Gene Symbol Dab2
Ensembl Gene ENSMUSG00000022150
Gene Namedisabled 2, mitogen-responsive phosphoprotein
Synonyms5730435J12Rik, p96, D630005B22Rik, D15Wsu122e
MMRRC Submission 038536-MU
Accession Numbers

Genbank: NM_023118, NM_001008702, MGI: 109175

Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6299788-6440712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6418316 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 60 (V60M)
Ref Sequence ENSEMBL: ENSMUSP00000125696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110663] [ENSMUST00000110664] [ENSMUST00000159046] [ENSMUST00000159490] [ENSMUST00000160134] [ENSMUST00000161040] [ENSMUST00000161812] [ENSMUST00000162094]
Predicted Effect probably damaging
Transcript: ENSMUST00000078019
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000080880
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000110663
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106291
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000110664
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159046
Predicted Effect probably damaging
Transcript: ENSMUST00000159490
AA Change: V60M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124145
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:1P3R|C 35 60 4e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159552
Predicted Effect probably damaging
Transcript: ENSMUST00000160134
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125021
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161040
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124478
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161558
Predicted Effect probably damaging
Transcript: ENSMUST00000161812
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124589
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 249 267 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
low complexity region 314 334 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
PDB:3H8D|H 444 472 2e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000162094
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125696
Gene: ENSMUSG00000022150
AA Change: V60M

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
Pfam:PID 50 110 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163082
SMART Domains Protein: ENSMUSP00000124996
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
Blast:PTB 2 59 1e-33 BLAST
PDB:1P3R|C 2 59 2e-34 PDB
SCOP:d1ddma_ 3 59 9e-12 SMART
low complexity region 60 79 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 441 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
PDB:3H8D|H 551 579 3e-12 PDB
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-responsive phosphoprotein. It is expressed in normal ovarian epithelial cells, but is down-regulated or absent from ovarian carcinoma cell lines, suggesting its role as a tumor suppressor. This protein binds to the SH3 domains of GRB2, an adaptor protein that couples tyrosine kinase receptors to SOS (a guanine nucleotide exchange factor for Ras), via its C-terminal proline-rich sequences, and may thus modulate growth factor/Ras pathways by competing with SOS for binding to GRB2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants exhibit abnormal primitive endoderm structure and/or function, lack a proamniotic cavity and die prior to embryonic day 9.5. A conditional mutant survives, but shows kidney proximal tubule abnormality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Dab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dab2 APN 15 6429825 missense probably benign 0.00
IGL00731:Dab2 APN 15 6435710 missense possibly damaging 0.95
IGL02382:Dab2 APN 15 6436987 missense possibly damaging 0.62
IGL02598:Dab2 APN 15 6429366 missense probably damaging 0.97
IGL03054:Dab2 APN 15 6418226 unclassified probably benign
IGL03093:Dab2 APN 15 6436411 missense probably damaging 1.00
IGL03369:Dab2 APN 15 6435309 missense possibly damaging 0.64
IGL03372:Dab2 APN 15 6429549 missense probably damaging 0.99
R0157:Dab2 UTSW 15 6429827 missense probably benign 0.00
R0488:Dab2 UTSW 15 6424654 missense probably damaging 1.00
R0552:Dab2 UTSW 15 6435414 missense possibly damaging 0.65
R0938:Dab2 UTSW 15 6435384 missense probably benign 0.04
R1433:Dab2 UTSW 15 6429938 missense probably damaging 1.00
R1635:Dab2 UTSW 15 6429870 missense possibly damaging 0.80
R1713:Dab2 UTSW 15 6429701 missense possibly damaging 0.94
R1757:Dab2 UTSW 15 6330452 intron probably benign
R1800:Dab2 UTSW 15 6435467 missense probably benign
R1837:Dab2 UTSW 15 6336476 intron probably benign
R1999:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2050:Dab2 UTSW 15 6435215 missense possibly damaging 0.47
R2117:Dab2 UTSW 15 6435615 missense probably damaging 1.00
R2129:Dab2 UTSW 15 6336383 nonsense probably null
R2150:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2329:Dab2 UTSW 15 6429563 missense possibly damaging 0.80
R2338:Dab2 UTSW 15 6435252 missense possibly damaging 0.62
R2680:Dab2 UTSW 15 6436993 missense possibly damaging 0.89
R3978:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3979:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3980:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R4551:Dab2 UTSW 15 6435294 missense probably damaging 0.97
R4795:Dab2 UTSW 15 6429611 missense probably benign 0.16
R4829:Dab2 UTSW 15 6424681 missense probably damaging 1.00
R4830:Dab2 UTSW 15 6427527 missense probably benign
R4832:Dab2 UTSW 15 6336599 splice site probably null
R5168:Dab2 UTSW 15 6336443 intron probably benign
R5620:Dab2 UTSW 15 6418315 missense probably damaging 0.98
R5996:Dab2 UTSW 15 6435311 nonsense probably null
R6159:Dab2 UTSW 15 6436460 missense possibly damaging 0.93
R6998:Dab2 UTSW 15 6424649 missense possibly damaging 0.49
R7002:Dab2 UTSW 15 6435365 missense probably benign 0.01
R7040:Dab2 UTSW 15 6422251 missense probably damaging 1.00
R7138:Dab2 UTSW 15 6429299 missense probably benign 0.24
R7448:Dab2 UTSW 15 6422266 missense probably damaging 1.00
R7548:Dab2 UTSW 15 6429918 missense possibly damaging 0.80
R8062:Dab2 UTSW 15 6427341 missense probably damaging 0.99
R8124:Dab2 UTSW 15 6429397 nonsense probably null
R8164:Dab2 UTSW 15 6430968 missense possibly damaging 0.92
R8171:Dab2 UTSW 15 6423926 missense probably benign 0.00
R8230:Dab2 UTSW 15 6422343 missense probably damaging 1.00
R8372:Dab2 UTSW 15 6416925 missense possibly damaging 0.80
R8427:Dab2 UTSW 15 6429359 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGAGACTGCACAGCCTGTTTG -3'
(R):5'- GCCCTGGCTTCTCTGAAAAGAGAAC -3'

Sequencing Primer
(F):5'- ACAGTCAGTATTCAATTTTTGGGG -3'
(R):5'- CTTCTCTGAAAAGAGAACACTGG -3'
Posted On2013-04-16