Incidental Mutation 'R3237:Myrip'
ID259102
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Namemyosin VIIA and Rab interacting protein
SynonymsA230081N12Rik, Slac2-c
MMRRC Submission 040619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3237 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120301513-120474841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120441407 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 574 (D574E)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048121
AA Change: D574E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: D574E

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccm2 G A 11: 6,570,090 V53I probably benign Het
Cd3e G T 9: 45,002,310 C42* probably null Het
Cd4 A T 6: 124,867,670 I384N probably benign Het
Ceacam11 T A 7: 17,973,454 F54L probably benign Het
Cfap46 A G 7: 139,617,590 S2122P probably damaging Het
Clptm1 A G 7: 19,635,346 S461P probably damaging Het
Dlat T C 9: 50,638,031 T518A possibly damaging Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Fam181a T G 12: 103,316,089 C84W possibly damaging Het
Fam198a C T 9: 121,964,869 P30S possibly damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Inpp5b A G 4: 124,780,486 R329G probably benign Het
Klrb1f A T 6: 129,054,343 I168L possibly damaging Het
Lama4 A T 10: 39,097,179 I1581F probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lyzl4 T C 9: 121,584,167 D65G probably benign Het
Med29 A G 7: 28,392,621 probably benign Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Nlrp9a A T 7: 26,571,385 K892* probably null Het
Nsd1 T A 13: 55,312,888 H2309Q possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Optn T C 2: 5,034,203 S370G probably damaging Het
Pbrm1 T C 14: 31,032,475 F151L probably damaging Het
Plekhs1 A T 19: 56,464,600 probably null Het
Rpn1 A G 6: 88,103,414 K565R probably benign Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr1 C T 7: 29,069,650 probably null Het
Scai C T 2: 39,150,314 probably benign Het
Scap C G 9: 110,379,582 P564A probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Slc41a3 T C 6: 90,636,865 Y226H probably benign Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Sned1 G A 1: 93,259,003 R180Q probably benign Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
St8sia3 T C 18: 64,269,815 F175S probably damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Syngap1 T A 17: 26,957,093 Y118* probably null Het
Szt2 A C 4: 118,383,034 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba3 G T 6: 97,186,240 T319K probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zc3hav1 A G 6: 38,319,715 L751S probably damaging Het
Zfp804b T C 5: 6,769,239 M1275V probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120467517 missense probably damaging 0.98
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3912:Myrip UTSW 9 120432616 missense probably benign
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4126:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGACTTGCTGTTGCCCTG -3'
(R):5'- CACATTGAGGGGAAAGCTTTCTG -3'

Sequencing Primer
(F):5'- CTGGGCTTCCTTACCTGGG -3'
(R):5'- AAAGCTTTCTGGGGCCAG -3'
Posted On2015-01-23