Incidental Mutation 'R3176:Hao2'
ID259131
Institutional Source Beutler Lab
Gene Symbol Hao2
Ensembl Gene ENSMUSG00000027870
Gene Namehydroxyacid oxidase 2
SynonymsHao3
MMRRC Submission 040614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3176 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98874521-98893239 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 98880328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029464]
Predicted Effect probably benign
Transcript: ENSMUST00000029464
SMART Domains Protein: ENSMUSP00000029464
Gene: ENSMUSG00000027870

DomainStartEndE-ValueType
Pfam:FMN_dh 13 350 1.8e-127 PFAM
Pfam:Glu_synthase 258 314 1.1e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity. The encoded protein localizes to the peroxisome has the highest activity toward the substrate 2-hydroxypalmitate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Electrophoretic variants are known for this locus in kidney. The a allele determines a slow anodally migrating band in all inbred strains tested; the b allele determines a fast band in M. m. castaneus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Ces2a A G 8: 104,739,378 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dcp1a A G 14: 30,505,542 probably benign Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Dtx3l A G 16: 35,932,173 S688P probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Kif15 T C 9: 122,987,840 probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nbeal2 G A 9: 110,636,887 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Hao2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Hao2 APN 3 98880332 splice site probably benign
IGL03279:Hao2 APN 3 98880396 missense possibly damaging 0.88
goatherd UTSW 3 98877135 missense probably benign 0.06
R0600:Hao2 UTSW 3 98883560 splice site probably benign
R1298:Hao2 UTSW 3 98883669 missense possibly damaging 0.94
R3177:Hao2 UTSW 3 98880328 splice site probably benign
R3786:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R4486:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4487:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4488:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R5290:Hao2 UTSW 3 98877177 missense probably damaging 0.99
R5760:Hao2 UTSW 3 98880432 nonsense probably null
R6129:Hao2 UTSW 3 98880526 missense probably benign 0.00
R6720:Hao2 UTSW 3 98877135 missense probably benign 0.06
R6861:Hao2 UTSW 3 98877182 missense probably damaging 1.00
R6991:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R7203:Hao2 UTSW 3 98877282 splice site probably null
R8277:Hao2 UTSW 3 98880384 missense probably damaging 1.00
Z1088:Hao2 UTSW 3 98875352 missense probably damaging 1.00
Z1177:Hao2 UTSW 3 98881942 missense probably benign 0.02
Z1177:Hao2 UTSW 3 98882041 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGACAGGGGCTTCAATGC -3'
(R):5'- CTGCTGGAATGATCTCCCCTTG -3'

Sequencing Primer
(F):5'- GTCTACTGTGAACCTGTACTCATTAG -3'
(R):5'- GGAATGATCTCCCCTTGCTTCAGAG -3'
Posted On2015-01-23