Incidental Mutation 'R3176:Padi6'
ID 259133
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms ePAD, Padi5, Pad6
MMRRC Submission 040614-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3176 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 140454666-140469954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140462700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 307 (L307P)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]
AlphaFold Q8K3V4
Predicted Effect probably damaging
Transcript: ENSMUST00000038749
AA Change: L307P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: L307P

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125046
Predicted Effect probably benign
Transcript: ENSMUST00000130267
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Meta Mutation Damage Score 0.1502 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 87,233,495 (GRCm39) R1269H probably damaging Het
Ace A G 11: 105,867,528 (GRCm39) E164G probably null Het
Als2 A T 1: 59,209,167 (GRCm39) V1464E possibly damaging Het
Atox1 A G 11: 55,341,379 (GRCm39) L52P possibly damaging Het
Btnl10 A G 11: 58,813,216 (GRCm39) K282E probably benign Het
Cdkn3 T C 14: 47,008,934 (GRCm39) probably benign Het
Ces2a A G 8: 105,466,010 (GRCm39) probably benign Het
Col16a1 A G 4: 129,951,792 (GRCm39) K72E probably damaging Het
Col6a5 G A 9: 105,788,306 (GRCm39) R1565* probably null Het
Col6a6 T C 9: 105,663,429 (GRCm39) H36R probably benign Het
Cyp4b1 T C 4: 115,483,047 (GRCm39) N415D possibly damaging Het
Dcp1a A G 14: 30,227,499 (GRCm39) probably benign Het
Dennd4a G T 9: 64,796,275 (GRCm39) R767L probably damaging Het
Dhcr24 T C 4: 106,418,436 (GRCm39) F25L probably benign Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Dhx58 A G 11: 100,587,805 (GRCm39) F584S probably damaging Het
Dmbt1 A G 7: 130,689,801 (GRCm39) T715A probably benign Het
Dtx3l A G 16: 35,752,543 (GRCm39) S688P probably benign Het
Eogt T A 6: 97,108,355 (GRCm39) I229F probably benign Het
Ern2 T C 7: 121,780,187 (GRCm39) T164A possibly damaging Het
Fam133b A T 5: 3,608,522 (GRCm39) N84I probably damaging Het
Fbxl21 T A 13: 56,684,935 (GRCm39) Y346* probably null Het
Fcgbp C A 7: 27,791,086 (GRCm39) H782Q probably damaging Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hao2 T C 3: 98,787,644 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Itgav A G 2: 83,606,886 (GRCm39) D409G probably damaging Het
Kcnt2 A G 1: 140,537,377 (GRCm39) N1119S probably benign Het
Kif15 T C 9: 122,816,905 (GRCm39) probably benign Het
Klhl32 T C 4: 24,682,063 (GRCm39) I207V probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lhfpl5 T C 17: 28,798,920 (GRCm39) I143T possibly damaging Het
Lrrk1 T C 7: 65,955,269 (GRCm39) K431E possibly damaging Het
Mag C T 7: 30,601,073 (GRCm39) probably null Het
Maml3 A T 3: 51,764,351 (GRCm39) N204K possibly damaging Het
Mmut A G 17: 41,269,763 (GRCm39) probably null Het
Mrpl19 T C 6: 81,941,047 (GRCm39) S115G probably damaging Het
Mthfd1l G C 10: 4,098,025 (GRCm39) G954A probably damaging Het
Myo19 A G 11: 84,783,001 (GRCm39) I172V probably benign Het
Naca T C 10: 127,876,530 (GRCm39) probably benign Het
Nbeal2 G A 9: 110,465,955 (GRCm39) probably benign Het
Nfatc2 T C 2: 168,348,914 (GRCm39) N638D possibly damaging Het
Or52r1c C A 7: 102,734,957 (GRCm39) D72E probably damaging Het
Or8b49 T A 9: 38,505,939 (GRCm39) C141S probably damaging Het
Or9s27 A G 1: 92,516,535 (GRCm39) N161S probably benign Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Prcd A G 11: 116,550,637 (GRCm39) E103G possibly damaging Het
Prkx A T X: 76,814,881 (GRCm39) F260I probably damaging Het
Rad54l2 A G 9: 106,631,142 (GRCm39) probably null Het
Rb1cc1 T A 1: 6,319,590 (GRCm39) M1003K probably benign Het
Scap A T 9: 110,203,093 (GRCm39) M256L probably benign Het
Sema4c C T 1: 36,588,960 (GRCm39) R722H possibly damaging Het
Septin4 T C 11: 87,458,070 (GRCm39) V148A possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Sp110 A C 1: 85,505,050 (GRCm39) F434C probably benign Het
Spata7 A G 12: 98,603,857 (GRCm39) N75D possibly damaging Het
Tmem120b T A 5: 123,252,167 (GRCm39) I146N probably damaging Het
Ttc23l A G 15: 10,547,318 (GRCm39) F99L possibly damaging Het
Ube3a T A 7: 58,926,267 (GRCm39) C348* probably null Het
Ubr4 T A 4: 139,149,166 (GRCm39) D1777E probably benign Het
Unc79 C A 12: 103,079,476 (GRCm39) D1880E probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140,454,934 (GRCm39) missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140,456,314 (GRCm39) missense probably damaging 0.98
IGL01068:Padi6 APN 4 140,458,264 (GRCm39) missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140,469,235 (GRCm39) missense probably benign 0.24
streetwise UTSW 4 140,468,869 (GRCm39) nonsense probably null
R0097:Padi6 UTSW 4 140,458,268 (GRCm39) missense probably benign 0.09
R0097:Padi6 UTSW 4 140,458,268 (GRCm39) missense probably benign 0.09
R0135:Padi6 UTSW 4 140,464,663 (GRCm39) missense probably benign 0.04
R0437:Padi6 UTSW 4 140,456,240 (GRCm39) missense probably benign 0.01
R1581:Padi6 UTSW 4 140,463,147 (GRCm39) missense probably damaging 1.00
R2024:Padi6 UTSW 4 140,456,279 (GRCm39) missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140,462,700 (GRCm39) missense probably damaging 1.00
R3177:Padi6 UTSW 4 140,462,700 (GRCm39) missense probably damaging 1.00
R3276:Padi6 UTSW 4 140,462,700 (GRCm39) missense probably damaging 1.00
R3277:Padi6 UTSW 4 140,462,700 (GRCm39) missense probably damaging 1.00
R4168:Padi6 UTSW 4 140,469,245 (GRCm39) missense probably damaging 0.99
R4727:Padi6 UTSW 4 140,458,506 (GRCm39) missense probably damaging 1.00
R5063:Padi6 UTSW 4 140,469,191 (GRCm39) missense probably benign 0.01
R5382:Padi6 UTSW 4 140,458,521 (GRCm39) missense probably damaging 1.00
R5408:Padi6 UTSW 4 140,454,996 (GRCm39) missense probably damaging 1.00
R5604:Padi6 UTSW 4 140,458,473 (GRCm39) missense probably damaging 0.96
R5790:Padi6 UTSW 4 140,459,569 (GRCm39) missense probably damaging 1.00
R7084:Padi6 UTSW 4 140,468,869 (GRCm39) nonsense probably null
R7533:Padi6 UTSW 4 140,458,506 (GRCm39) missense probably damaging 1.00
R7581:Padi6 UTSW 4 140,456,240 (GRCm39) missense probably benign 0.01
R7662:Padi6 UTSW 4 140,456,306 (GRCm39) missense probably benign 0.00
R7766:Padi6 UTSW 4 140,458,286 (GRCm39) missense probably benign 0.02
R7872:Padi6 UTSW 4 140,455,073 (GRCm39) missense probably damaging 1.00
R8333:Padi6 UTSW 4 140,464,687 (GRCm39) missense probably damaging 1.00
R8347:Padi6 UTSW 4 140,462,719 (GRCm39) missense probably benign 0.00
R8550:Padi6 UTSW 4 140,460,014 (GRCm39) missense probably benign 0.15
R8979:Padi6 UTSW 4 140,466,474 (GRCm39) missense probably benign 0.03
R9628:Padi6 UTSW 4 140,464,626 (GRCm39) missense probably damaging 1.00
RF007:Padi6 UTSW 4 140,457,054 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTATACAGACTGGACCCTTAAGG -3'
(R):5'- AGCAGGCTCAGATGAACAGC -3'

Sequencing Primer
(F):5'- TGACTGCACTGATGAGTCAC -3'
(R):5'- CTCAGATGAACAGCGGGGTG -3'
Posted On 2015-01-23