Mutagenetix > Incidental Mutations

Incidental Mutation 'R3176:Dmbt1'

259139

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin

MMRRC Submission

040614-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.355) question?

Stock #

R3176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131032053-131121630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 131088071 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 715 (T715A)

Ref Sequence

ENSEMBL: ENSMUSP00000148657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

Predicted Effect

unknown
Transcript: ENSMUST00000084509
AA Change: T878A

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: T878A

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208311
AA Change: T889A

Predicted Effect

probably benign
Transcript: ENSMUST00000213064
AA Change: T715A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (28/28)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	C	T	8: 86,506,866	R1269H	probably damaging	Het
Ace	A	G	11: 105,976,702	E164G	probably null	Het
Als2	A	T	1: 59,170,008	V1464E	possibly damaging	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Cdkn3	T	C	14: 46,771,477		probably benign	Het
Ces2a	A	G	8: 104,739,378		probably benign	Het
Col16a1	A	G	4: 130,057,999	K72E	probably damaging	Het
Col6a5	G	A	9: 105,911,107	R1565*	probably null	Het
Col6a6	T	C	9: 105,786,230	H36R	probably benign	Het
Cyp4b1	T	C	4: 115,625,850	N415D	possibly damaging	Het
Dcp1a	A	G	14: 30,505,542		probably benign	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dhcr24	T	C	4: 106,561,239	F25L	probably benign	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Dhx58	A	G	11: 100,696,979	F584S	probably damaging	Het
Dtx3l	A	G	16: 35,932,173	S688P	probably benign	Het
Eogt	T	A	6: 97,131,394	I229F	probably benign	Het
Ern2	T	C	7: 122,180,964	T164A	possibly damaging	Het
Fam133b	A	T	5: 3,558,522	N84I	probably damaging	Het
Fbxl21	T	A	13: 56,537,122	Y346*	probably null	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hao2	T	C	3: 98,880,328		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kcnt2	A	G	1: 140,609,639	N1119S	probably benign	Het
Kif15	T	C	9: 122,987,840		probably benign	Het
Klhl32	T	C	4: 24,682,063	I207V	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lhfpl5	T	C	17: 28,579,946	I143T	possibly damaging	Het
Lrrk1	T	C	7: 66,305,521	K431E	possibly damaging	Het
Mag	C	T	7: 30,901,648		probably null	Het
Maml3	A	T	3: 51,856,930	N204K	possibly damaging	Het
Mrpl19	T	C	6: 81,964,066	S115G	probably damaging	Het
Mthfd1l	G	C	10: 4,148,025	G954A	probably damaging	Het
Mut	A	G	17: 40,958,872		probably null	Het
Myo19	A	G	11: 84,892,175	I172V	probably benign	Het
Naca	T	C	10: 128,040,661		probably benign	Het
Nbeal2	G	A	9: 110,636,887		probably benign	Het
Nfatc2	T	C	2: 168,506,994	N638D	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr584	C	A	7: 103,085,750	D72E	probably damaging	Het
Olfr913	T	A	9: 38,594,643	C141S	probably damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Prcd	A	G	11: 116,659,811	E103G	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Rad54l2	A	G	9: 106,753,943		probably null	Het
Rb1cc1	T	A	1: 6,249,366	M1003K	probably benign	Het
Scap	A	T	9: 110,374,025	M256L	probably benign	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Sp110	A	C	1: 85,577,329	F434C	probably benign	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Tmem120b	T	A	5: 123,114,104	I146N	probably damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Ube3a	T	A	7: 59,276,519	C348*	probably null	Het
Ubr4	T	A	4: 139,421,855	D1777E	probably benign	Het
Unc79	C	A	12: 103,113,217	D1880E	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	131079540	intron	probably benign
IGL00161:Dmbt1	APN	7	131109628	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	131099290	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	131082500	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	131097607	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	131058158	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	131085368	splice site	probably benign
IGL01317:Dmbt1	APN	7	131041191	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	131088767	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	131103679	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	131116728	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	131081185	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	131074419	intron	probably benign
IGL02160:Dmbt1	APN	7	131082688	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	131093256	splice site	probably benign
IGL02197:Dmbt1	APN	7	131085422	splice site	probably benign
IGL02332:Dmbt1	APN	7	131066613	intron	probably benign
IGL02427:Dmbt1	APN	7	131088085	splice site	probably null
IGL02726:Dmbt1	APN	7	131074410	intron	probably benign
IGL02967:Dmbt1	APN	7	131071189	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	131082679	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	131111049	missense	probably damaging	0.99
H8562:Dmbt1	UTSW	7	131112076	nonsense	probably null
K3955:Dmbt1	UTSW	7	131119564	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	131106393	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	131096049	splice site	probably benign
R0427:Dmbt1	UTSW	7	131040902	nonsense	probably null
R0478:Dmbt1	UTSW	7	131041187	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	131097673	splice site	probably null
R0538:Dmbt1	UTSW	7	131049901	splice site	probably benign
R0626:Dmbt1	UTSW	7	131102081	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	131097653	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	131093117	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	131074524	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	131050214	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	131044487	splice site	probably benign
R1463:Dmbt1	UTSW	7	131109637	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	131074331	intron	probably benign
R1990:Dmbt1	UTSW	7	131058288	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	131106359	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	131099133	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	131050018	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	131102032	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	131097575	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	131046562	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	131090494	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	131106468	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	131094734	nonsense	probably null
R3014:Dmbt1	UTSW	7	131032097	intron	probably benign
R3155:Dmbt1	UTSW	7	131050157	nonsense	probably null
R3276:Dmbt1	UTSW	7	131088071	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	131106249	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	131112090	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	131074202	intron	probably benign
R4396:Dmbt1	UTSW	7	131116632	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	131040934	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	131050012	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	131094742	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	131097670	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	131094735	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	131082619	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	131041021	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	131119511	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	131040993	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	131063403	intron	probably benign
R5526:Dmbt1	UTSW	7	131041190	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	131099300	nonsense	probably null
R5566:Dmbt1	UTSW	7	131106273	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	131054067	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	131109641	splice site	probably null
R6188:Dmbt1	UTSW	7	131097631	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	131066733	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	131066733	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	131058254	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	131103578	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	131116641	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	131046510	intron	probably null
R6719:Dmbt1	UTSW	7	131119603	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	131046561	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	131066734	nonsense	probably null
R7191:Dmbt1	UTSW	7	131044520	missense	unknown
R7269:Dmbt1	UTSW	7	131066621	missense	unknown
R7288:Dmbt1	UTSW	7	131083789	nonsense	probably null
R7296:Dmbt1	UTSW	7	131112132	missense	unknown
R7349:Dmbt1	UTSW	7	131041124	missense	unknown
R7386:Dmbt1	UTSW	7	131112236	missense	unknown
R7428:Dmbt1	UTSW	7	131108463	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	131079511	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	131066462	missense	unknown
R7513:Dmbt1	UTSW	7	131090512	missense	unknown
R7553:Dmbt1	UTSW	7	131104867	missense	unknown
R7567:Dmbt1	UTSW	7	131061363	splice site	probably null
R7584:Dmbt1	UTSW	7	131088751	nonsense	probably null
X0024:Dmbt1	UTSW	7	131112248	nonsense	probably null
X0062:Dmbt1	UTSW	7	131094851	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CACATGAGAGCTCAGTCAGG -3'
(R):5'- TCTTTGCTGATAAGAGTGTCAGTC -3'

Sequencing Primer
(F):5'- GGACACCGCATGATCTCAAGG -3'
(R):5'- AAGAGTGTCAGTCTTTCTAGGGAAC -3'

Posted On

2015-01-23