Incidental Mutation 'R3176:Col6a6'
ID259142
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Namecollagen, type VI, alpha 6
SynonymsE330026B02Rik
MMRRC Submission 040614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3176 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105687809-105828160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105786230 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 36 (H36R)
Ref Sequence ENSEMBL: ENSMUSP00000125765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]
Predicted Effect probably benign
Transcript: ENSMUST00000060896
AA Change: H36R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: H36R

DomainStartEndE-ValueType
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098441
AA Change: H36R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: H36R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166431
AA Change: H36R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: H36R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (28/28)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Ces2a A G 8: 104,739,378 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dcp1a A G 14: 30,505,542 probably benign Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Dtx3l A G 16: 35,932,173 S688P probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Kif15 T C 9: 122,987,840 probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nbeal2 G A 9: 110,636,887 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- CTTCAGGTGGTTCAGCATGG -3'
(R):5'- CTCCTTTTCCTGAGCGATTATATATGG -3'

Sequencing Primer
(F):5'- CAGCATGGGGTTCCTGTTC -3'
(R):5'- CCTGAGCGATTATATATGGTGTTAC -3'
Posted On2015-01-23