Incidental Mutation 'R3176:Dhx58'
ID259148
Institutional Source Beutler Lab
Gene Symbol Dhx58
Ensembl Gene ENSMUSG00000017830
Gene NameDEXH (Asp-Glu-X-His) box polypeptide 58
SynonymsD11Lgp2e, B430001I08Rik, LPG2
MMRRC Submission 040614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R3176 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100694884-100704271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100696979 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 584 (F584S)
Ref Sequence ENSEMBL: ENSMUSP00000017974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017974] [ENSMUST00000153494]
Predicted Effect probably damaging
Transcript: ENSMUST00000017974
AA Change: F584S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017974
Gene: ENSMUSG00000017830
AA Change: F584S

DomainStartEndE-ValueType
DEXDc 2 207 2.86e-22 SMART
HELICc 387 475 3.85e-14 SMART
Blast:HELICc 497 543 4e-12 BLAST
Pfam:RIG-I_C-RD 552 667 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149869
Predicted Effect probably benign
Transcript: ENSMUST00000153494
SMART Domains Protein: ENSMUSP00000115268
Gene: ENSMUSG00000014198

DomainStartEndE-ValueType
Pfam:zf-met 42 67 6.4e-8 PFAM
low complexity region 79 102 N/A INTRINSIC
Meta Mutation Damage Score 0.8758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (28/28)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to EMCV infection and decreased susceptibility to VSV infection. Mice homozygous for a different knock-out allele exhibit increased susceptibility to WNV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Ces2a A G 8: 104,739,378 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dcp1a A G 14: 30,505,542 probably benign Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Dtx3l A G 16: 35,932,173 S688P probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Kif15 T C 9: 122,987,840 probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nbeal2 G A 9: 110,636,887 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Dhx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Dhx58 APN 11 100703926 missense probably damaging 0.97
IGL02476:Dhx58 APN 11 100702264 missense probably benign 0.00
R0103:Dhx58 UTSW 11 100695270 missense probably damaging 1.00
R0103:Dhx58 UTSW 11 100695270 missense probably damaging 1.00
R0137:Dhx58 UTSW 11 100696997 missense probably damaging 0.99
R0164:Dhx58 UTSW 11 100695324 missense probably benign 0.42
R0164:Dhx58 UTSW 11 100695324 missense probably benign 0.42
R0369:Dhx58 UTSW 11 100701548 critical splice donor site probably null
R0390:Dhx58 UTSW 11 100699264 missense probably damaging 1.00
R0606:Dhx58 UTSW 11 100702251 missense probably benign 0.00
R1710:Dhx58 UTSW 11 100703574 missense probably benign 0.20
R1816:Dhx58 UTSW 11 100703152 missense probably damaging 0.98
R1993:Dhx58 UTSW 11 100703490 splice site probably null
R2281:Dhx58 UTSW 11 100698154 critical splice donor site probably null
R3276:Dhx58 UTSW 11 100696979 missense probably damaging 1.00
R4651:Dhx58 UTSW 11 100701359 missense probably damaging 1.00
R4652:Dhx58 UTSW 11 100701359 missense probably damaging 1.00
R4716:Dhx58 UTSW 11 100696971 splice site probably null
R5030:Dhx58 UTSW 11 100696137 missense probably damaging 1.00
R5082:Dhx58 UTSW 11 100696976 missense probably benign 0.29
R5098:Dhx58 UTSW 11 100695173 missense probably benign
R5394:Dhx58 UTSW 11 100698208 missense probably benign 0.00
R5397:Dhx58 UTSW 11 100703920 missense probably damaging 1.00
R5787:Dhx58 UTSW 11 100701319 missense possibly damaging 0.91
R5975:Dhx58 UTSW 11 100702209 missense probably damaging 0.98
R6310:Dhx58 UTSW 11 100699367 missense probably benign 0.01
R6935:Dhx58 UTSW 11 100698406 splice site probably null
R7311:Dhx58 UTSW 11 100698171 missense probably benign
R7908:Dhx58 UTSW 11 100695304 missense probably damaging 0.99
R8317:Dhx58 UTSW 11 100703562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCCTACTGAGTGACATAGAC -3'
(R):5'- AGCATCTCTAGTTAAGCGGGC -3'

Sequencing Primer
(F):5'- TGAGTGACATAGACAGGCTACCTC -3'
(R):5'- CATCAACTGTATGGTGGC -3'
Posted On2015-01-23