Incidental Mutation 'R3176:Prkx'
ID259153
Institutional Source Beutler Lab
Gene Symbol Prkx
Ensembl Gene ENSMUSG00000035725
Gene Nameprotein kinase, X-linked
SynonymsPkare
MMRRC Submission 040614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R3176 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location77761411-77796278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77771275 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 260 (F260I)
Ref Sequence ENSEMBL: ENSMUSP00000045304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036333] [ENSMUST00000114044]
Predicted Effect probably damaging
Transcript: ENSMUST00000036333
AA Change: F260I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045304
Gene: ENSMUSG00000035725
AA Change: F260I

DomainStartEndE-ValueType
S_TKc 46 300 5.53e-99 SMART
S_TK_X 301 355 8.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114044
SMART Domains Protein: ENSMUSP00000109678
Gene: ENSMUSG00000035725

DomainStartEndE-ValueType
Pfam:Pkinase 46 237 1.1e-59 PFAM
Pfam:Pkinase_Tyr 47 237 2.6e-33 PFAM
Pfam:Kinase-like 131 237 1.3e-7 PFAM
Meta Mutation Damage Score 0.7454 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine threonine protein kinase that has similarity to the catalytic subunit of cyclic AMP dependent protein kinases. The encoded protein is developmentally regulated and may be involved in renal epithelial morphogenesis. This protein may also be involved in macrophage and granulocyte maturation. Abnormal recombination between this gene and a related pseudogene on chromosome Y is a frequent cause of sex reversal disorder in XX males and XY females. Pseudogenes of this gene are found on chromosomes X, 15 and Y. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Ces2a A G 8: 104,739,378 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dcp1a A G 14: 30,505,542 probably benign Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Dtx3l A G 16: 35,932,173 S688P probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Kif15 T C 9: 122,987,840 probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nbeal2 G A 9: 110,636,887 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Prkx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03218:Prkx APN X 77786200 missense probably damaging 1.00
R2019:Prkx UTSW X 77765404 missense probably damaging 1.00
R2157:Prkx UTSW X 77771314 missense probably benign 0.12
R3149:Prkx UTSW X 77771275 missense probably damaging 0.99
R3276:Prkx UTSW X 77771275 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCAAATCTGCGTTAATTTCAACAC -3'
(R):5'- CAAGCAGTGGATCCATTTGAC -3'

Sequencing Primer
(F):5'- AATCTGCGTTAATTTCAACACTGTCC -3'
(R):5'- CTCTACTAAATATCCATGCTTCT -3'
Posted On2015-01-23