Incidental Mutation 'R3177:Itgad'
ID259166
Institutional Source Beutler Lab
Gene Symbol Itgad
Ensembl Gene ENSMUSG00000070369
Gene Nameintegrin, alpha D
SynonymsCd11d
MMRRC Submission 040615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3177 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128154376-128223816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128190981 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 651 (H651N)
Ref Sequence ENSEMBL: ENSMUSP00000033051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000177111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033051
AA Change: H651N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: H651N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 376 1.24e-36 SMART
Blast:VWA 405 436 1e-9 BLAST
Int_alpha 443 492 3.67e-3 SMART
Int_alpha 496 553 1.03e-6 SMART
Int_alpha 559 615 1.73e-13 SMART
Int_alpha 622 676 1.69e-2 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Pfam:Integrin_alpha 1165 1179 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106237
AA Change: H617N

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369
AA Change: H617N

DomainStartEndE-ValueType
Int_alpha 40 90 1.35e1 SMART
VWA 157 342 1.31e-44 SMART
Blast:VWA 371 402 9e-10 BLAST
Int_alpha 409 458 3.67e-3 SMART
Int_alpha 462 519 1.03e-6 SMART
Int_alpha 525 581 1.73e-13 SMART
Int_alpha 588 642 1.69e-2 SMART
transmembrane domain 1108 1130 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 4.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177111
AA Change: H615N

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: H615N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 340 1.31e-44 SMART
Blast:VWA 369 400 9e-10 BLAST
Int_alpha 407 456 3.67e-3 SMART
Int_alpha 460 517 1.03e-6 SMART
Int_alpha 523 579 1.73e-13 SMART
Int_alpha 586 640 1.69e-2 SMART
transmembrane domain 1106 1128 N/A INTRINSIC
Pfam:Integrin_alpha 1129 1143 5.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205646
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (21/21)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyb561 T C 11: 105,935,787 probably benign Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5581 C G 6: 131,166,965 noncoding transcript Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Itgad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Itgad APN 7 128203850 missense probably damaging 0.99
IGL02036:Itgad APN 7 128189821 missense possibly damaging 0.49
IGL02589:Itgad APN 7 128181711 missense probably damaging 1.00
IGL02648:Itgad APN 7 128183374 intron probably benign
IGL02735:Itgad APN 7 128193716 missense probably damaging 1.00
IGL03088:Itgad APN 7 128203032 missense probably benign 0.01
IGL03110:Itgad APN 7 128185985 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0184:Itgad UTSW 7 128189231 missense probably benign 0.02
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0282:Itgad UTSW 7 128189978 splice site probably benign
R0326:Itgad UTSW 7 128198378 missense probably benign 0.00
R0646:Itgad UTSW 7 128174004 missense possibly damaging 0.89
R0947:Itgad UTSW 7 128175693 missense probably benign 0.08
R1439:Itgad UTSW 7 128183006 missense probably benign 0.44
R1454:Itgad UTSW 7 128192137 missense probably benign 0.02
R1503:Itgad UTSW 7 128198121 missense probably benign 0.00
R1531:Itgad UTSW 7 128178370 missense probably benign 0.00
R1572:Itgad UTSW 7 128203234 missense probably damaging 1.00
R1602:Itgad UTSW 7 128190939 missense probably damaging 1.00
R1732:Itgad UTSW 7 128205107 missense probably benign
R2278:Itgad UTSW 7 128205170 missense possibly damaging 0.93
R2851:Itgad UTSW 7 128204560 missense probably benign 0.01
R3029:Itgad UTSW 7 128178371 missense possibly damaging 0.85
R3080:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R3150:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3176:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3276:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3277:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3833:Itgad UTSW 7 128186233 missense probably damaging 1.00
R4541:Itgad UTSW 7 128198115 missense probably benign 0.13
R4649:Itgad UTSW 7 128189531 missense probably benign 0.01
R4753:Itgad UTSW 7 128223703 makesense probably null
R4852:Itgad UTSW 7 128198530 missense probably damaging 1.00
R4931:Itgad UTSW 7 128204625 missense probably damaging 1.00
R4970:Itgad UTSW 7 128189843 missense possibly damaging 0.70
R5116:Itgad UTSW 7 128203893 missense probably damaging 1.00
R5183:Itgad UTSW 7 128198223 critical splice donor site probably null
R5233:Itgad UTSW 7 128193428 splice site probably null
R5334:Itgad UTSW 7 128189286 missense probably damaging 0.99
R5731:Itgad UTSW 7 128198554 missense probably benign 0.19
R5760:Itgad UTSW 7 128203365 missense probably benign 0.02
R5896:Itgad UTSW 7 128174016 missense probably benign 0.34
R5955:Itgad UTSW 7 128189481 missense probably benign 0.00
R6247:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R6659:Itgad UTSW 7 128185948 missense probably damaging 1.00
R7027:Itgad UTSW 7 128182989 missense probably damaging 1.00
R7104:Itgad UTSW 7 128198378 missense probably benign 0.00
R7120:Itgad UTSW 7 128173974 start codon destroyed probably null 0.02
R7272:Itgad UTSW 7 128205073 missense probably damaging 1.00
R7303:Itgad UTSW 7 128190179 missense probably benign
R7324:Itgad UTSW 7 128189807 missense probably damaging 1.00
R7565:Itgad UTSW 7 128183015 missense probably damaging 0.98
R7566:Itgad UTSW 7 128192107 missense probably benign 0.40
RF019:Itgad UTSW 7 128192208 missense probably benign 0.08
Z1176:Itgad UTSW 7 128190087 missense probably damaging 1.00
Z1177:Itgad UTSW 7 128189501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGACTTGTAAGAGGGTC -3'
(R):5'- AGTCTTTGCCACCTCTGAGG -3'

Sequencing Primer
(F):5'- ACTGCTTGCTTTAACTCCAGAC -3'
(R):5'- CCTCTGAGGGGGCAAATCTAATG -3'
Posted On2015-01-23