Incidental Mutation 'R3177:Hpgd'
ID259168
Institutional Source Beutler Lab
Gene Symbol Hpgd
Ensembl Gene ENSMUSG00000031613
Gene Namehydroxyprostaglandin dehydrogenase 15 (NAD)
Synonyms15-PGDH
MMRRC Submission 040615-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3177 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location56294585-56321043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56298413 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 92 (A92E)
Ref Sequence ENSEMBL: ENSMUSP00000034026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034026]
Predicted Effect probably damaging
Transcript: ENSMUST00000034026
AA Change: A92E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034026
Gene: ENSMUSG00000031613
AA Change: A92E

DomainStartEndE-ValueType
Pfam:KR 6 175 6.6e-11 PFAM
Pfam:adh_short 6 199 1.7e-59 PFAM
Pfam:adh_short_C2 12 252 1.3e-18 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (21/21)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutation of this gene results failure of the ductus arteriosus to close and perinatal lethality. Mutant animals die within 12-48 hours after birth due to congestive heart failure. Mice homozygous for a hypomorphic allele exhibit preterm labor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyb561 T C 11: 105,935,787 probably benign Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5581 C G 6: 131,166,965 noncoding transcript Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Hpgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Hpgd APN 8 56319062 missense probably benign 0.04
R0703:Hpgd UTSW 8 56295039 missense probably damaging 1.00
R0705:Hpgd UTSW 8 56295039 missense probably damaging 1.00
R1138:Hpgd UTSW 8 56307677 missense probably benign 0.00
R2081:Hpgd UTSW 8 56307642 missense probably benign
R3277:Hpgd UTSW 8 56298413 missense probably damaging 1.00
R3782:Hpgd UTSW 8 56298418 missense probably damaging 1.00
R4774:Hpgd UTSW 8 56298419 missense probably damaging 1.00
R4874:Hpgd UTSW 8 56317803 missense possibly damaging 0.78
R5501:Hpgd UTSW 8 56298356 missense probably benign 0.04
R5828:Hpgd UTSW 8 56319071 missense probably benign 0.10
R5846:Hpgd UTSW 8 56307667 missense possibly damaging 0.90
R6136:Hpgd UTSW 8 56294952 missense probably damaging 1.00
R7252:Hpgd UTSW 8 56298426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTTGATTAGAAGACGCAACC -3'
(R):5'- AATGCACTGAACTCTGCTTCTC -3'

Sequencing Primer
(F):5'- GCAACCTAAATTCAACCTCTAGTG -3'
(R):5'- TCTCTAACCCTTTAAGAGAGATTCTC -3'
Posted On2015-01-23