Incidental Mutation 'R3177:Cyp4f18'
ID259169
Institutional Source Beutler Lab
Gene Symbol Cyp4f18
Ensembl Gene ENSMUSG00000003484
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms1810054N16Rik
MMRRC Submission 040615-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3177 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71988482-72009626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71993200 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 317 (D317G)
Ref Sequence ENSEMBL: ENSMUSP00000003574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003574]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003574
AA Change: D317G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003574
Gene: ENSMUSG00000003484
AA Change: D317G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 516 2.7e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136878
Predicted Effect probably benign
Transcript: ENSMUST00000141975
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (21/21)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F11, is approximately 16 kb away. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukotriene B4 metabolism but show no significant alterations in inflammatory cell infiltration or injury following renal ischemia-reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyb561 T C 11: 105,935,787 probably benign Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5581 C G 6: 131,166,965 noncoding transcript Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Cyp4f18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cyp4f18 APN 8 71989927 missense probably damaging 0.96
IGL01465:Cyp4f18 APN 8 72002444 missense probably benign
IGL01863:Cyp4f18 APN 8 71989926 missense possibly damaging 0.49
IGL02403:Cyp4f18 APN 8 71998228 missense probably damaging 0.97
IGL03244:Cyp4f18 APN 8 71988645 missense probably benign 0.12
R0226:Cyp4f18 UTSW 8 71989775 splice site probably benign
R0310:Cyp4f18 UTSW 8 72001012 splice site probably benign
R0486:Cyp4f18 UTSW 8 71996017 missense probably benign 0.02
R0506:Cyp4f18 UTSW 8 71996000 missense probably benign 0.00
R0547:Cyp4f18 UTSW 8 71996010 missense probably benign 0.00
R0689:Cyp4f18 UTSW 8 71995968 missense probably benign
R0721:Cyp4f18 UTSW 8 72001135 missense probably benign 0.02
R1534:Cyp4f18 UTSW 8 71992955 missense probably damaging 1.00
R2087:Cyp4f18 UTSW 8 72000988 missense probably benign
R2902:Cyp4f18 UTSW 8 72002411 missense probably damaging 0.96
R3149:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3150:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3277:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3906:Cyp4f18 UTSW 8 72001082 splice site probably benign
R3916:Cyp4f18 UTSW 8 71996037 missense probably benign 0.03
R3953:Cyp4f18 UTSW 8 72000957 missense probably damaging 1.00
R4815:Cyp4f18 UTSW 8 71995995 missense possibly damaging 0.52
R4915:Cyp4f18 UTSW 8 72009054 missense probably damaging 1.00
R5086:Cyp4f18 UTSW 8 72002432 missense probably benign 0.00
R5113:Cyp4f18 UTSW 8 71989058 critical splice donor site probably null
R5202:Cyp4f18 UTSW 8 72009096 missense probably benign 0.03
R5761:Cyp4f18 UTSW 8 71996131 missense probably damaging 0.99
R6187:Cyp4f18 UTSW 8 71993186 missense probably damaging 0.98
R6664:Cyp4f18 UTSW 8 71989915 missense probably benign 0.21
R6944:Cyp4f18 UTSW 8 71989894 missense probably benign 0.03
R6978:Cyp4f18 UTSW 8 72002496 missense probably benign
R7288:Cyp4f18 UTSW 8 71993173 missense probably damaging 1.00
R7326:Cyp4f18 UTSW 8 71988654 missense probably benign 0.14
R7432:Cyp4f18 UTSW 8 71996062 missense probably benign 0.00
R7871:Cyp4f18 UTSW 8 71988643 missense possibly damaging 0.69
R7954:Cyp4f18 UTSW 8 71988643 missense possibly damaging 0.69
R8063:Cyp4f18 UTSW 8 71998231 missense probably damaging 1.00
Z1177:Cyp4f18 UTSW 8 71998283 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGGTGTCATGGCCTGAAAG -3'
(R):5'- GGGACTCTGGTAAAGTACACAG -3'

Sequencing Primer
(F):5'- GGGTCTCTAGGCTGCTTCAG -3'
(R):5'- CTCTGGTAAAGTACACAGGTGCAG -3'
Posted On2015-01-23