Incidental Mutation 'R3177:Parp9'
ID259176
Institutional Source Beutler Lab
Gene Symbol Parp9
Ensembl Gene ENSMUSG00000022906
Gene Namepoly (ADP-ribose) polymerase family, member 9
Synonyms
MMRRC Submission 040615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R3177 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35938470-35972605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35948208 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 20 (S20P)
Ref Sequence ENSEMBL: ENSMUSP00000023622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023622] [ENSMUST00000114877] [ENSMUST00000114878] [ENSMUST00000122870]
Predicted Effect probably damaging
Transcript: ENSMUST00000023622
AA Change: S20P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023622
Gene: ENSMUSG00000022906
AA Change: S20P

DomainStartEndE-ValueType
Pfam:Macro 74 182 1.5e-16 PFAM
PDB:3HKV|B 386 559 3e-9 PDB
SCOP:d1a26_2 403 521 1e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114877
SMART Domains Protein: ENSMUSP00000110527
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
A1pp 121 257 6.75e-33 SMART
A1pp 325 451 9.37e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114878
AA Change: S253P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110528
Gene: ENSMUSG00000022906
AA Change: S253P

DomainStartEndE-ValueType
A1pp 85 221 6.75e-33 SMART
A1pp 289 415 9.37e-9 SMART
PDB:3HKV|B 619 792 4e-8 PDB
SCOP:d1a26_2 636 754 1e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153066
Predicted Effect probably benign
Transcript: ENSMUST00000159160
SMART Domains Protein: ENSMUSP00000124098
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 29 100 8.3e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (21/21)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyb561 T C 11: 105,935,787 probably benign Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5581 C G 6: 131,166,965 noncoding transcript Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Parp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Parp9 APN 16 35947998 missense probably damaging 1.00
IGL01365:Parp9 APN 16 35947954 missense possibly damaging 0.71
IGL01628:Parp9 APN 16 35956915 missense possibly damaging 0.58
IGL02274:Parp9 APN 16 35947947 missense probably damaging 1.00
IGL02693:Parp9 APN 16 35956970 missense probably benign 0.01
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R0559:Parp9 UTSW 16 35947992 missense probably benign 0.00
R1126:Parp9 UTSW 16 35947740 missense possibly damaging 0.53
R1346:Parp9 UTSW 16 35956897 missense probably benign 0.00
R1472:Parp9 UTSW 16 35953680 missense possibly damaging 0.78
R1642:Parp9 UTSW 16 35967697 missense probably benign 0.37
R1900:Parp9 UTSW 16 35972221 missense probably benign 0.00
R2055:Parp9 UTSW 16 35953614 missense probably damaging 0.97
R3277:Parp9 UTSW 16 35948208 missense probably damaging 0.99
R4039:Parp9 UTSW 16 35960047 missense probably damaging 1.00
R4869:Parp9 UTSW 16 35956904 missense probably damaging 0.99
R4950:Parp9 UTSW 16 35948007 missense probably damaging 1.00
R5112:Parp9 UTSW 16 35964313 missense probably damaging 1.00
R5117:Parp9 UTSW 16 35971832 splice site probably null
R5180:Parp9 UTSW 16 35953736 nonsense probably null
R5415:Parp9 UTSW 16 35943382 missense probably damaging 0.97
R5535:Parp9 UTSW 16 35956825 missense probably damaging 0.98
R5727:Parp9 UTSW 16 35964097 nonsense probably null
R5842:Parp9 UTSW 16 35943408 missense possibly damaging 0.46
R5942:Parp9 UTSW 16 35971889 missense possibly damaging 0.90
R6110:Parp9 UTSW 16 35953626 missense possibly damaging 0.86
R6193:Parp9 UTSW 16 35947551 missense possibly damaging 0.64
R6707:Parp9 UTSW 16 35947933 missense probably damaging 1.00
R6957:Parp9 UTSW 16 35948346 missense probably benign 0.00
R7014:Parp9 UTSW 16 35960063 critical splice donor site probably null
R7064:Parp9 UTSW 16 35953672 missense probably benign 0.07
R7205:Parp9 UTSW 16 35956990 missense probably benign 0.00
R7221:Parp9 UTSW 16 35953701 missense probably benign 0.00
R7693:Parp9 UTSW 16 35956912 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CGCATTAAGACAGTAGCAATTCCAG -3'
(R):5'- ACAGCCTTCCACTTTAAGCATC -3'

Sequencing Primer
(F):5'- GTAGCAATTCCAGCCCTGAG -3'
(R):5'- GATTAACCATTAATTCCAGGACTCC -3'
Posted On2015-01-23