Incidental Mutation 'R3401:Ndrg3'
ID259180
Institutional Source Beutler Lab
Gene Symbol Ndrg3
Ensembl Gene ENSMUSG00000027634
Gene NameN-myc downstream regulated gene 3
Synonyms4833415O14Rik, Ndr3
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156927345-156992056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156948288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 92 (V92M)
Ref Sequence ENSEMBL: ENSMUSP00000070052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069600] [ENSMUST00000072298] [ENSMUST00000109558]
Predicted Effect probably damaging
Transcript: ENSMUST00000069600
AA Change: V92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070052
Gene: ENSMUSG00000027634
AA Change: V92M

DomainStartEndE-ValueType
Pfam:Ndr 32 317 1.1e-129 PFAM
low complexity region 335 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072298
AA Change: V92M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072144
Gene: ENSMUSG00000027634
AA Change: V92M

DomainStartEndE-ValueType
Pfam:Ndr 32 317 1.9e-129 PFAM
Pfam:Abhydrolase_6 58 305 1.6e-13 PFAM
low complexity region 322 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109558
AA Change: V92M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105185
Gene: ENSMUSG00000027634
AA Change: V92M

DomainStartEndE-ValueType
Pfam:Ndr 32 252 1.8e-99 PFAM
Pfam:Abhydrolase_6 55 237 6.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156651
Meta Mutation Damage Score 0.6595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Ndrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Ndrg3 APN 2 156950032 critical splice donor site probably null
R0277:Ndrg3 UTSW 2 156934935 utr 3 prime probably benign
R1335:Ndrg3 UTSW 2 156946008 splice site probably benign
R1370:Ndrg3 UTSW 2 156938650 missense probably damaging 1.00
R3236:Ndrg3 UTSW 2 156944037 missense probably damaging 0.97
R3403:Ndrg3 UTSW 2 156948288 missense probably damaging 1.00
R3522:Ndrg3 UTSW 2 156944027 missense probably damaging 0.99
R4282:Ndrg3 UTSW 2 156948294 missense possibly damaging 0.80
R5256:Ndrg3 UTSW 2 156931205 unclassified probably benign
R5894:Ndrg3 UTSW 2 156928778 missense probably benign 0.13
R6399:Ndrg3 UTSW 2 156940374 missense probably damaging 0.99
R7781:Ndrg3 UTSW 2 156928813 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTACAGCCTCTTATAGCCCA -3'
(R):5'- CTGGAGTGGACTGCTGAGGA -3'

Sequencing Primer
(F):5'- ATGCCTGCCTAGAGAACTTG -3'
(R):5'- CTGCTGAGGAGAAGGGACTG -3'
Posted On2015-01-23