Incidental Mutation 'R3401:Zfp157'
ID259184
Institutional Source Beutler Lab
Gene Symbol Zfp157
Ensembl Gene ENSMUSG00000036898
Gene Namezinc finger protein 157
Synonyms
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138441468-138460694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138457011 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 490 (N490K)
Ref Sequence ENSEMBL: ENSMUSP00000083018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085856] [ENSMUST00000100524] [ENSMUST00000110912]
Predicted Effect probably benign
Transcript: ENSMUST00000085856
AA Change: N490K

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083018
Gene: ENSMUSG00000036898
AA Change: N490K

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
ZnF_C2H2 183 205 3.69e-4 SMART
ZnF_C2H2 211 233 3.16e-3 SMART
ZnF_C2H2 239 261 3.63e-3 SMART
ZnF_C2H2 267 289 2.24e-3 SMART
ZnF_C2H2 295 317 1.47e-3 SMART
ZnF_C2H2 323 345 1.95e-3 SMART
ZnF_C2H2 351 373 1.28e-3 SMART
ZnF_C2H2 379 401 2.4e-3 SMART
ZnF_C2H2 407 429 9.73e-4 SMART
ZnF_C2H2 435 457 4.4e-2 SMART
ZnF_C2H2 463 485 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100524
SMART Domains Protein: ENSMUSP00000098093
Gene: ENSMUSG00000036898

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110912
SMART Domains Protein: ENSMUSP00000106537
Gene: ENSMUSG00000036898

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display accelerated ductal elongation during puberty and accelerated alveologenesis during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Zfp157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Zfp157 APN 5 138447578 missense probably benign 0.02
IGL02377:Zfp157 APN 5 138447597 nonsense probably null
R1476:Zfp157 UTSW 5 138455095 critical splice donor site probably null
R1883:Zfp157 UTSW 5 138444840 missense probably damaging 1.00
R1884:Zfp157 UTSW 5 138444840 missense probably damaging 1.00
R4237:Zfp157 UTSW 5 138447541 missense probably damaging 1.00
R4239:Zfp157 UTSW 5 138447541 missense probably damaging 1.00
R4573:Zfp157 UTSW 5 138456929 missense probably damaging 0.97
R4785:Zfp157 UTSW 5 138444789 missense probably damaging 1.00
R4914:Zfp157 UTSW 5 138456295 missense possibly damaging 0.85
R5476:Zfp157 UTSW 5 138457181 missense possibly damaging 0.92
R6128:Zfp157 UTSW 5 138455019 missense possibly damaging 0.95
R6473:Zfp157 UTSW 5 138455926 missense probably damaging 0.99
R6572:Zfp157 UTSW 5 138457051 missense possibly damaging 0.92
R6990:Zfp157 UTSW 5 138456510 nonsense probably null
R7638:Zfp157 UTSW 5 138455910 missense probably benign 0.04
R8057:Zfp157 UTSW 5 138456074 missense probably damaging 1.00
Z1088:Zfp157 UTSW 5 138457199 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAAGTCAACCCTTCGTG -3'
(R):5'- TAGCGTGTCTCACCTGAGTTC -3'

Sequencing Primer
(F):5'- GGCAAGGCTTTCTTCTACAAG -3'
(R):5'- TTCACATTGAATGAGGCATGAG -3'
Posted On2015-01-23