Incidental Mutation 'R3401:Ppp1r37'
ID259186
Institutional Source Beutler Lab
Gene Symbol Ppp1r37
Ensembl Gene ENSMUSG00000051403
Gene Nameprotein phosphatase 1, regulatory subunit 37
SynonymsLrrc68
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R3401 (G1)
Quality Score222
Status Validated
Chromosome7
Chromosomal Location19530800-19563076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19532787 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 392 (A392T)
Ref Sequence ENSEMBL: ENSMUSP00000060233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058444]
Predicted Effect probably damaging
Transcript: ENSMUST00000058444
AA Change: A392T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060233
Gene: ENSMUSG00000051403
AA Change: A392T

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
Blast:LRR 139 166 1e-9 BLAST
LRR 224 251 1.77e2 SMART
LRR 252 280 3.52e-1 SMART
LRR 281 308 8.27e-7 SMART
LRR 310 337 3.05e1 SMART
LRR 338 365 1.4e-4 SMART
LRR 366 393 1.56e-2 SMART
LRR 394 421 2.36e-2 SMART
low complexity region 504 540 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 596 628 N/A INTRINSIC
low complexity region 660 679 N/A INTRINSIC
low complexity region 696 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209190
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Ppp1r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0313:Ppp1r37 UTSW 7 19533998 missense probably damaging 1.00
R0718:Ppp1r37 UTSW 7 19532254 missense probably benign
R0883:Ppp1r37 UTSW 7 19532177 missense probably benign 0.01
R1606:Ppp1r37 UTSW 7 19534999 missense probably damaging 0.97
R2220:Ppp1r37 UTSW 7 19532446 missense probably null 0.43
R2256:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2257:Ppp1r37 UTSW 7 19562018 unclassified probably benign
R2325:Ppp1r37 UTSW 7 19532684 missense probably damaging 1.00
R2510:Ppp1r37 UTSW 7 19532432 missense possibly damaging 0.79
R3402:Ppp1r37 UTSW 7 19532787 missense probably damaging 0.99
R4006:Ppp1r37 UTSW 7 19535069 missense probably damaging 1.00
R4750:Ppp1r37 UTSW 7 19531520 missense probably benign
R4956:Ppp1r37 UTSW 7 19532711 nonsense probably null
R5156:Ppp1r37 UTSW 7 19561975 unclassified probably benign
R5582:Ppp1r37 UTSW 7 19532294 missense probably damaging 1.00
R5659:Ppp1r37 UTSW 7 19535523 missense probably damaging 1.00
R5918:Ppp1r37 UTSW 7 19532111 missense probably benign 0.02
R6172:Ppp1r37 UTSW 7 19532404 missense possibly damaging 0.93
R6659:Ppp1r37 UTSW 7 19532123 missense probably benign 0.00
R7626:Ppp1r37 UTSW 7 19561853 missense probably damaging 0.99
R7779:Ppp1r37 UTSW 7 19532787 missense possibly damaging 0.81
R7785:Ppp1r37 UTSW 7 19532071 missense probably damaging 1.00
R7819:Ppp1r37 UTSW 7 19534064 missense probably damaging 1.00
Z1177:Ppp1r37 UTSW 7 19535072 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCTCTTCACCTGTGGG -3'
(R):5'- TCAAGAATGGGCTCATCAGC -3'

Sequencing Primer
(F):5'- TCTTCACCTGTGGGACCCAG -3'
(R):5'- TCATCAGCAACCGCAGTGTG -3'
Posted On2015-01-23