Incidental Mutation 'R3401:Tead2'
ID259187
Institutional Source Beutler Lab
Gene Symbol Tead2
Ensembl Gene ENSMUSG00000030796
Gene NameTEA domain family member 2
SynonymsTEAD-2, TEF-4, Etdf
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45215753-45233644 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 45223673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033060] [ENSMUST00000097216] [ENSMUST00000107801] [ENSMUST00000209343] [ENSMUST00000209437] [ENSMUST00000209678] [ENSMUST00000210447] [ENSMUST00000211744]
Predicted Effect probably benign
Transcript: ENSMUST00000033060
SMART Domains Protein: ENSMUSP00000033060
Gene: ENSMUSG00000030796

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000097216
SMART Domains Protein: ENSMUSP00000103430
Gene: ENSMUSG00000030796

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
Pfam:TEA 40 402 1.8e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107801
SMART Domains Protein: ENSMUSP00000103431
Gene: ENSMUSG00000030796

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209343
Predicted Effect probably benign
Transcript: ENSMUST00000209437
Predicted Effect probably benign
Transcript: ENSMUST00000209678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209818
Predicted Effect probably benign
Transcript: ENSMUST00000210447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211138
Predicted Effect probably benign
Transcript: ENSMUST00000211744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211778
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a functionally null allele of this gene exhibit no gross abnormalities and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Tead2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Tead2 APN 7 45217251 missense probably damaging 0.96
IGL01887:Tead2 APN 7 45232310 missense probably damaging 1.00
IGL02378:Tead2 APN 7 45218147 critical splice donor site probably null
IGL02441:Tead2 APN 7 45217421 missense probably damaging 1.00
IGL02716:Tead2 APN 7 45232296 nonsense probably null
IGL02939:Tead2 APN 7 45220434 splice site probably benign
IGL03302:Tead2 APN 7 45232899 missense possibly damaging 0.86
R0325:Tead2 UTSW 7 45225755 missense probably damaging 1.00
R0611:Tead2 UTSW 7 45217250 missense probably damaging 0.99
R2571:Tead2 UTSW 7 45225770 missense probably damaging 1.00
R3847:Tead2 UTSW 7 45232328 unclassified probably null
R3849:Tead2 UTSW 7 45232328 unclassified probably null
R3850:Tead2 UTSW 7 45232328 unclassified probably null
R5729:Tead2 UTSW 7 45220742 unclassified probably benign
R5932:Tead2 UTSW 7 45232899 missense probably benign 0.00
R5956:Tead2 UTSW 7 45220714 unclassified probably benign
R6208:Tead2 UTSW 7 45218102 missense probably damaging 1.00
R6729:Tead2 UTSW 7 45217234 missense probably benign
R7152:Tead2 UTSW 7 45220447 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCTCATGGTTGGGACTAACTG -3'
(R):5'- TTGACTACTCGGTTGTGCC -3'

Sequencing Primer
(F):5'- GGAGTTCAGGCTTTATGGCAC -3'
(R):5'- TACTCGGTTGTGCCCAGCTG -3'
Posted On2015-01-23