Incidental Mutation 'R3401:Vmn2r68'
ID 259188
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms EG620697, Vmn2r68-ps
MMRRC Submission 040620-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R3401 (G1)
Quality Score 217
Status Validated
Chromosome 7
Chromosomal Location 84870726-84886912 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TCC to TC at 84870758 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably null
Transcript: ENSMUST00000061074
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,667,149 (GRCm39) T127K probably damaging Het
Cactin G A 10: 81,161,709 (GRCm39) R747H probably benign Het
Cul5 A T 9: 53,532,512 (GRCm39) M747K probably benign Het
Dennd4c C T 4: 86,692,780 (GRCm39) P97S probably damaging Het
Dnah3 A G 7: 119,566,879 (GRCm39) V2449A probably benign Het
Eif1ad T C 19: 5,418,276 (GRCm39) V20A probably benign Het
Faim2 C T 15: 99,418,229 (GRCm39) V119I probably damaging Het
Fli1 G A 9: 32,372,570 (GRCm39) S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 (GRCm39) D399E probably benign Het
Hip1r A G 5: 124,135,046 (GRCm39) E394G probably damaging Het
Htr2a T C 14: 74,882,499 (GRCm39) S162P probably damaging Het
Naip5 G A 13: 100,358,411 (GRCm39) Q942* probably null Het
Ndrg3 C T 2: 156,790,208 (GRCm39) V92M probably damaging Het
Nlrp4d A T 7: 10,096,781 (GRCm39) N906K probably damaging Het
Pkd2 A G 5: 104,628,193 (GRCm39) I422M possibly damaging Het
Polr3b C T 10: 84,535,355 (GRCm39) T888M probably damaging Het
Ppp1r37 C T 7: 19,266,712 (GRCm39) A392T probably damaging Het
Ralgapa1 T C 12: 55,705,922 (GRCm39) T2323A possibly damaging Het
Sntg2 A G 12: 30,338,171 (GRCm39) probably benign Het
Stard9 A G 2: 120,534,170 (GRCm39) I3476V probably damaging Het
Tead2 T A 7: 44,873,097 (GRCm39) probably benign Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Tmem74 C T 15: 43,730,417 (GRCm39) V209M probably damaging Het
Trim25 T C 11: 88,901,707 (GRCm39) M334T probably benign Het
Uprt A G X: 103,549,864 (GRCm39) D310G probably damaging Het
Zfp157 T A 5: 138,455,273 (GRCm39) N490K probably benign Het
Zhx1 T C 15: 57,917,745 (GRCm39) E167G probably benign Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 84,886,819 (GRCm39) missense probably benign
IGL01477:Vmn2r68 APN 7 84,882,691 (GRCm39) missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 84,871,468 (GRCm39) missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 84,871,325 (GRCm39) missense probably benign
IGL01999:Vmn2r68 APN 7 84,871,439 (GRCm39) missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 84,870,947 (GRCm39) missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 84,871,153 (GRCm39) nonsense probably null
IGL02827:Vmn2r68 APN 7 84,886,800 (GRCm39) missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 84,882,595 (GRCm39) missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 84,883,649 (GRCm39) missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 84,871,448 (GRCm39) nonsense probably null
IGL03166:Vmn2r68 APN 7 84,871,331 (GRCm39) missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 84,870,972 (GRCm39) missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 84,882,963 (GRCm39) missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0280:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0281:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0348:Vmn2r68 UTSW 7 84,870,884 (GRCm39) missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0390:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0722:Vmn2r68 UTSW 7 84,870,794 (GRCm39) missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 84,886,712 (GRCm39) splice site probably null
R1136:Vmn2r68 UTSW 7 84,871,549 (GRCm39) missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 84,881,700 (GRCm39) missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 84,870,946 (GRCm39) missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 84,882,574 (GRCm39) missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 84,882,886 (GRCm39) missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 84,883,867 (GRCm39) nonsense probably null
R1908:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 84,883,102 (GRCm39) missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 84,871,123 (GRCm39) missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2185:Vmn2r68 UTSW 7 84,882,901 (GRCm39) nonsense probably null
R2188:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2282:Vmn2r68 UTSW 7 84,870,859 (GRCm39) missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 84,883,803 (GRCm39) missense probably benign
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 84,886,875 (GRCm39) missense probably benign 0.00
R3978:Vmn2r68 UTSW 7 84,881,670 (GRCm39) missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4421:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4478:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4479:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4495:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4628:Vmn2r68 UTSW 7 84,883,673 (GRCm39) missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 84,870,743 (GRCm39) missense probably benign
R4654:Vmn2r68 UTSW 7 84,882,769 (GRCm39) nonsense probably null
R4793:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 84,881,622 (GRCm39) missense probably benign
R5021:Vmn2r68 UTSW 7 84,882,942 (GRCm39) missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 84,883,076 (GRCm39) missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 84,871,199 (GRCm39) missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 84,871,085 (GRCm39) missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 84,886,767 (GRCm39) missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 84,882,926 (GRCm39) missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 84,871,283 (GRCm39) missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 84,882,978 (GRCm39) missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 84,886,812 (GRCm39) missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 84,871,453 (GRCm39) missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 84,883,048 (GRCm39) missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 84,870,973 (GRCm39) missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 84,882,915 (GRCm39) missense probably benign
R6699:Vmn2r68 UTSW 7 84,881,583 (GRCm39) missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 84,871,460 (GRCm39) missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 84,883,042 (GRCm39) missense probably benign
R7374:Vmn2r68 UTSW 7 84,881,607 (GRCm39) missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 84,881,587 (GRCm39) missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 84,883,116 (GRCm39) missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 84,883,722 (GRCm39) missense probably benign
R7979:Vmn2r68 UTSW 7 84,883,625 (GRCm39) critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 84,871,422 (GRCm39) nonsense probably null
R8349:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 84,871,108 (GRCm39) missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 84,886,722 (GRCm39) missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 84,871,321 (GRCm39) missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 84,871,420 (GRCm39) missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 84,882,993 (GRCm39) missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 84,882,757 (GRCm39) missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 84,871,289 (GRCm39) missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 84,870,941 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 84,871,307 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CATGTCTGTACTATCAACATGGC -3'
(R):5'- TGCAGTGTCTGGATTACTTTCATCC -3'

Sequencing Primer
(F):5'- GTTTATTCAACAAACTGTGGTACAGG -3'
(R):5'- GGATTACTTTCATCCCTGTCTACCAC -3'
Posted On 2015-01-23