Mutagenetix > Incidental Mutation

Incidental Mutation 'R0326:Chd1'

25919

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

038536-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0326 (G1)

Quality Score

168

Status

Not validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 15768566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1527 (D1527V)

Ref Sequence

ENSEMBL: ENSMUSP00000024627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627]

AlphaFold

P40201

Predicted Effect

probably damaging
Transcript: ENSMUST00000024627
AA Change: D1527V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: D1527V

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.8%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	C	T	1: 130,742,898	P286S	possibly damaging	Het
Aagab	T	A	9: 63,619,162	S156T	probably damaging	Het
Abca14	T	G	7: 120,224,419	Y390D	probably damaging	Het
Abcc2	T	A	19: 43,825,947	I1122N	possibly damaging	Het
Adamts16	T	C	13: 70,779,611	E503G	possibly damaging	Het
Adamts9	A	T	6: 92,858,057	C697*	probably null	Het
Adgrv1	T	C	13: 81,474,993	D3837G	possibly damaging	Het
Aire	T	A	10: 78,042,599	R128S	probably damaging	Het
Alkbh2	A	C	5: 114,123,950	*240E	probably null	Het
Als2	T	C	1: 59,180,583	Y1191C	probably damaging	Het
Anapc5	A	T	5: 122,814,604	V186E	probably benign	Het
Apob	C	T	12: 7,990,307	A548V	probably damaging	Het
B3galt4	A	T	17: 33,950,748	V172E	probably damaging	Het
Bbs7	A	C	3: 36,592,376	C432G	possibly damaging	Het
Cacna2d3	T	A	14: 29,045,644	E758V	probably damaging	Het
Cactin	T	G	10: 81,322,662	L154R	probably benign	Het
Ccdc129	A	T	6: 55,898,243	M393L	possibly damaging	Het
Ccdc88a	A	C	11: 29,461,021	R502S	probably benign	Het
Ccnf	A	T	17: 24,231,810	I398N	possibly damaging	Het
Chrac1	G	A	15: 73,092,826		probably null	Het
Cln3	T	G	7: 126,583,045	M1L	probably damaging	Het
Cnot6	T	C	11: 49,677,436	Y442C	probably damaging	Het
Col19a1	A	T	1: 24,285,051		probably null	Het
Col1a2	T	C	6: 4,537,838	F1116L	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cops4	T	G	5: 100,528,542	V53G	probably damaging	Het
Crnkl1	A	G	2: 145,919,955	S561P	probably benign	Het
Ctnnb1	C	A	9: 120,951,712	Q99K	probably benign	Het
Cxcr5	T	C	9: 44,513,281	S360G	probably benign	Het
Dab2	G	A	15: 6,418,316	V60M	probably damaging	Het
Ddx3y	A	T	Y: 1,263,321	Y648*	probably null	Het
Dennd2a	T	A	6: 39,497,110	D430V	probably damaging	Het
Dsp	G	T	13: 38,192,870	E1544*	probably null	Het
Efcab7	A	T	4: 99,831,394	M38L	possibly damaging	Het
Fto	A	G	8: 91,409,527	N141S	probably damaging	Het
Gabrp	A	G	11: 33,554,362	F318L	probably damaging	Het
Gm4737	T	A	16: 46,153,883	D377V	probably benign	Het
Gmeb1	A	C	4: 132,242,352	C103W	probably damaging	Het
Heatr9	T	C	11: 83,514,539	D365G	probably damaging	Het
Hif3a	G	A	7: 17,044,400	R436W	probably benign	Het
Hint2	A	G	4: 43,654,378	V145A	probably damaging	Het
Hmcn2	T	A	2: 31,423,225	L3482*	probably null	Het
Hsd3b1	A	T	3: 98,853,274	Y134N	probably damaging	Het
Impg2	T	A	16: 56,260,485	V775E	probably damaging	Het
Ipo5	A	G	14: 120,922,223	I154M	probably benign	Het
Itgad	T	A	7: 128,198,378	F893Y	probably benign	Het
Kdm4a	T	C	4: 118,161,706	R438G	probably benign	Het
Klk11	T	A	7: 43,776,519	M1K	probably null	Het
Lama5	A	T	2: 180,182,426	V2602D	possibly damaging	Het
Lrch3	T	C	16: 32,979,500	S35P	probably damaging	Het
Mfn2	A	G	4: 147,883,288	L441P	probably damaging	Het
Mgat4c	A	T	10: 102,388,704	I260F	probably damaging	Het
Mon1b	T	A	8: 113,637,743	S51T	probably benign	Het
Myh11	T	C	16: 14,218,880	D993G	probably benign	Het
Myo1a	A	G	10: 127,716,297	N762D	probably benign	Het
Nacc2	A	T	2: 26,060,333	Y464N	probably damaging	Het
Nckap1	A	G	2: 80,553,370	I150T	probably benign	Het
Ndufv2	G	T	17: 66,080,821	P119T	probably damaging	Het
Noc4l	G	A	5: 110,652,375	R95*	probably null	Het
Ntng1	A	T	3: 110,135,503	Y2*	probably null	Het
Olfr1333	A	T	4: 118,829,825	V205D	possibly damaging	Het
Olfr1423	C	T	19: 12,036,161	V194I	probably benign	Het
Olfr1505	C	T	19: 13,919,509	T163I	probably benign	Het
Olfr804	A	G	10: 129,705,769	E297G	possibly damaging	Het
Oog4	T	C	4: 143,439,203	N53D	probably benign	Het
Phkg2	T	G	7: 127,573,903	L11R	probably damaging	Het
Pogz	A	G	3: 94,870,113	D368G	probably damaging	Het
Prex2	T	A	1: 11,285,065	L1530Q	probably damaging	Het
Prmt1	C	T	7: 44,979,454	E144K	probably damaging	Het
Prss8	T	A	7: 127,927,176	I121F	probably benign	Het
Psmd13	T	C	7: 140,897,711	L314P	probably damaging	Het
Ptch2	G	A	4: 117,108,884	G467D	probably damaging	Het
Rbm20	C	A	19: 53,864,165	P1192Q	probably damaging	Het
Rpl19	T	A	11: 98,028,374	D45E	probably benign	Het
Rsph10b	C	T	5: 143,967,128	A219V	probably damaging	Het
Rtraf	C	T	14: 19,814,532		probably null	Het
Scaf1	T	A	7: 45,008,751	T235S	probably damaging	Het
Shank1	T	A	7: 44,319,170	C296S	unknown	Het
Slc39a7	A	T	17: 34,028,950	V426D	probably damaging	Het
Slc41a2	A	T	10: 83,283,746	V384D	probably damaging	Het
Slco1c1	T	C	6: 141,559,773	L475P	probably benign	Het
Slco6d1	A	C	1: 98,490,634	K515T	probably benign	Het
Sos2	T	C	12: 69,635,685	E253G	probably damaging	Het
Sp6	G	T	11: 97,021,535	D25Y	possibly damaging	Het
Syt11	A	C	3: 88,762,548	D12E	possibly damaging	Het
Taf2	A	G	15: 55,047,460	L606P	probably damaging	Het
Tbc1d5	A	G	17: 50,966,736	Y116H	probably damaging	Het
Tnfrsf8	A	G	4: 145,288,459	I243T	possibly damaging	Het
Tnxb	A	G	17: 34,698,179	S2183G	probably benign	Het
Trim66	T	C	7: 109,460,172	Y853C	probably benign	Het
Ttn	T	A	2: 76,737,495	T27685S	probably damaging	Het
Ttn	T	C	2: 76,743,122	E25809G	probably damaging	Het
Uvssa	G	A	5: 33,408,847	G445S	probably benign	Het
Zfp326	T	C	5: 105,910,275	S427P	probably damaging	Het
Zfp592	A	G	7: 81,024,889	T534A	possibly damaging	Het
Zfp672	A	G	11: 58,316,347	S383P	possibly damaging	Het
Zfp799	A	G	17: 32,820,726	S188P	possibly damaging	Het
Zyg11b	A	C	4: 108,272,253	V54G	possibly damaging	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15725431	missense	probably benign
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15749894	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15770241	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4880:Chd1	UTSW	17	17374654	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15742231	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15754951	missense	probably benign	0.01
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17385613	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	splice site	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
R8194:Chd1	UTSW	17	17374475	start gained	probably benign
R8261:Chd1	UTSW	17	17387542	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15769980	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15743211	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15762449	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15730845	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15742289	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15735714	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15768761	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGCACATAAATAGAACCTGAGTCTTGT -3'
(R):5'- CGGTGGTCTTTGCCATTGCTAAATGA -3'

Sequencing Primer
(F):5'- gctttcccacctccgtc -3'
(R):5'- CCATTGCTAAATGAGGAGTAGGGTC -3'

Posted On

2013-04-16