Incidental Mutation 'R3401:Gucy1a2'
ID259191
Institutional Source Beutler Lab
Gene Symbol Gucy1a2
Ensembl Gene ENSMUSG00000041624
Gene Nameguanylate cyclase 1, soluble, alpha 2
Synonyms6330407I18Rik, A230060L24Rik
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location3532778-3894736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3635154 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 399 (D399E)
Ref Sequence ENSEMBL: ENSMUSP00000111398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115733]
Predicted Effect probably benign
Transcript: ENSMUST00000115733
AA Change: D399E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111398
Gene: ENSMUSG00000041624
AA Change: D399E

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 51 72 N/A INTRINSIC
Pfam:HNOB 121 268 3e-19 PFAM
PDB:4GJ4|D 316 441 1e-17 PDB
CYCc 483 674 6.58e-93 SMART
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213060
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display normal blood vessel and platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Gucy1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Gucy1a2 APN 9 3759418 missense probably damaging 1.00
IGL00768:Gucy1a2 APN 9 3635111 missense possibly damaging 0.65
IGL00928:Gucy1a2 APN 9 3759777 missense probably damaging 1.00
IGL01520:Gucy1a2 APN 9 3759561 missense probably damaging 0.99
IGL01566:Gucy1a2 APN 9 3634661 missense probably damaging 1.00
IGL01819:Gucy1a2 APN 9 3865409 nonsense probably null
IGL01874:Gucy1a2 APN 9 3797343 missense probably damaging 1.00
IGL02442:Gucy1a2 APN 9 3865385 missense probably damaging 1.00
IGL02608:Gucy1a2 APN 9 3635113 missense probably damaging 0.99
IGL02612:Gucy1a2 APN 9 3894556 missense possibly damaging 0.74
IGL02719:Gucy1a2 APN 9 3894719 utr 3 prime probably benign
IGL02823:Gucy1a2 APN 9 3894656 missense possibly damaging 0.79
IGL02852:Gucy1a2 APN 9 3759691 missense probably benign 0.31
IGL02892:Gucy1a2 APN 9 3634471 missense probably damaging 1.00
IGL02964:Gucy1a2 APN 9 3759542 missense probably damaging 0.96
Rico UTSW 9 3579513 splice site probably null
R0096:Gucy1a2 UTSW 9 3758928 intron probably benign
R0417:Gucy1a2 UTSW 9 3759484 missense possibly damaging 0.80
R0920:Gucy1a2 UTSW 9 3759472 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1146:Gucy1a2 UTSW 9 3759830 missense probably damaging 1.00
R1384:Gucy1a2 UTSW 9 3759620 missense probably damaging 1.00
R1631:Gucy1a2 UTSW 9 3533052 missense probably damaging 1.00
R1711:Gucy1a2 UTSW 9 3759622 missense probably benign 0.04
R1730:Gucy1a2 UTSW 9 3634957 missense probably benign 0.36
R1800:Gucy1a2 UTSW 9 3582685 missense possibly damaging 0.62
R2069:Gucy1a2 UTSW 9 3582697 missense probably damaging 1.00
R2166:Gucy1a2 UTSW 9 3579513 splice site probably null
R2357:Gucy1a2 UTSW 9 3797299 missense probably damaging 0.97
R3953:Gucy1a2 UTSW 9 3582704 splice site probably benign
R4420:Gucy1a2 UTSW 9 3634640 missense probably damaging 1.00
R4731:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4732:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4733:Gucy1a2 UTSW 9 3759424 missense probably benign 0.02
R4931:Gucy1a2 UTSW 9 3759588 missense probably damaging 1.00
R5094:Gucy1a2 UTSW 9 3865443 missense probably damaging 1.00
R5852:Gucy1a2 UTSW 9 3865460 missense probably damaging 0.99
R6005:Gucy1a2 UTSW 9 3865518 splice site probably null
R7667:Gucy1a2 UTSW 9 3759580 missense probably damaging 1.00
R7841:Gucy1a2 UTSW 9 3634766 missense probably benign 0.03
R7866:Gucy1a2 UTSW 9 3532804 start codon destroyed probably null
R7924:Gucy1a2 UTSW 9 3634766 missense probably benign 0.03
R7949:Gucy1a2 UTSW 9 3532804 start codon destroyed probably null
Z1176:Gucy1a2 UTSW 9 3635156 missense probably damaging 1.00
Z1177:Gucy1a2 UTSW 9 3797245 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTTGACTCTAACATGGTGGTCC -3'
(R):5'- CAGACACTATGTAAAATGCCTGGG -3'

Sequencing Primer
(F):5'- AACATGGTGGTCCTTCAGC -3'
(R):5'- TGCCTGGGAATATAGCCAACTC -3'
Posted On2015-01-23