Incidental Mutation 'R3401:Fli1'
ID259193
Institutional Source Beutler Lab
Gene Symbol Fli1
Ensembl Gene ENSMUSG00000016087
Gene NameFriend leukemia integration 1
SynonymsSIC-1, EWSR2, Sic1, Fli-1
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32422204-32542861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32461274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 156 (S156L)
Ref Sequence ENSEMBL: ENSMUSP00000138984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016231] [ENSMUST00000183767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016231
AA Change: S189L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016231
Gene: ENSMUSG00000016087
AA Change: S189L

DomainStartEndE-ValueType
SAM_PNT 114 198 2.52e-38 SMART
ETS 280 365 1.22e-57 SMART
low complexity region 402 414 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183767
AA Change: S156L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138984
Gene: ENSMUSG00000016087
AA Change: S156L

DomainStartEndE-ValueType
SAM_PNT 81 165 2.52e-38 SMART
Meta Mutation Damage Score 0.5365 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for most knock-out allele exhibit abnormal hematopoietic and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Fli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Fli1 APN 9 32423940 missense probably benign 0.31
IGL01329:Fli1 APN 9 32424101 missense probably damaging 1.00
IGL01925:Fli1 APN 9 32465831 missense probably damaging 1.00
IGL01951:Fli1 APN 9 32461364 missense probably damaging 0.99
IGL01963:Fli1 APN 9 32424207 nonsense probably null
IGL02889:Fli1 APN 9 32465696 missense probably damaging 1.00
R0026:Fli1 UTSW 9 32476584 missense probably damaging 1.00
R0243:Fli1 UTSW 9 32423981 missense probably benign 0.00
R0279:Fli1 UTSW 9 32461427 missense probably damaging 1.00
R0418:Fli1 UTSW 9 32452129 splice site probably benign
R0967:Fli1 UTSW 9 32461449 missense probably benign
R1228:Fli1 UTSW 9 32423843 missense probably damaging 1.00
R1557:Fli1 UTSW 9 32461244 splice site probably benign
R1875:Fli1 UTSW 9 32423913 missense probably benign 0.03
R3898:Fli1 UTSW 9 32476722 missense possibly damaging 0.88
R4051:Fli1 UTSW 9 32452162 missense probably benign 0.03
R6440:Fli1 UTSW 9 32423901 missense probably benign 0.07
R6901:Fli1 UTSW 9 32429925 missense probably benign 0.14
R7061:Fli1 UTSW 9 32424222 missense probably damaging 0.98
R7231:Fli1 UTSW 9 32424188 missense probably damaging 1.00
R7676:Fli1 UTSW 9 32428030 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCTTTGTAGGAACACATGTGAC -3'
(R):5'- TGCATGCTGACCGTTGTTATC -3'

Sequencing Primer
(F):5'- ACACATGTGACCTTGATGGG -3'
(R):5'- TGCAGACCCCACACTGTG -3'
Posted On2015-01-23