Incidental Mutation 'R3401:Cul5'
ID259194
Institutional Source Beutler Lab
Gene Symbol Cul5
Ensembl Gene ENSMUSG00000032030
Gene Namecullin 5
SynonymsVACM-1, C030032G03Rik, C330021I08Rik, 8430423K24Rik, 4921514I20Rik
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53614582-53670014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53621212 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 747 (M747K)
Ref Sequence ENSEMBL: ENSMUSP00000133144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034529] [ENSMUST00000120122] [ENSMUST00000166367]
Predicted Effect probably benign
Transcript: ENSMUST00000034529
AA Change: M774K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034529
Gene: ENSMUSG00000032030
AA Change: M774K

DomainStartEndE-ValueType
PDB:2WZK|A 76 461 N/A PDB
SCOP:d1ldja2 91 459 1e-109 SMART
CULLIN 510 661 1.12e-80 SMART
Cullin_Nedd8 782 849 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120122
AA Change: M570K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113490
Gene: ENSMUSG00000032030
AA Change: M570K

DomainStartEndE-ValueType
PDB:4JGH|D 1 258 N/A PDB
SCOP:d1ldja2 5 255 2e-75 SMART
CULLIN 306 457 1.12e-80 SMART
Cullin_Nedd8 578 645 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141803
Predicted Effect probably benign
Transcript: ENSMUST00000166367
AA Change: M747K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133144
Gene: ENSMUSG00000032030
AA Change: M747K

DomainStartEndE-ValueType
PDB:2WZK|A 76 434 N/A PDB
SCOP:d1ldja2 91 432 9e-99 SMART
CULLIN 483 634 1.12e-80 SMART
Cullin_Nedd8 755 822 5.12e-17 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality. Mice heterozygous for a null allele exhibit decreased susceptibility to LPS-induced lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Cul5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Cul5 APN 9 53635007 missense probably damaging 1.00
IGL02043:Cul5 APN 9 53658673 missense probably benign 0.26
IGL02145:Cul5 APN 9 53635075 splice site probably benign
IGL02261:Cul5 APN 9 53635037 missense probably damaging 1.00
IGL02281:Cul5 APN 9 53635049 missense possibly damaging 0.87
IGL02639:Cul5 APN 9 53655342 missense possibly damaging 0.89
IGL02697:Cul5 APN 9 53655331 missense probably benign
IGL02752:Cul5 APN 9 53634978 missense probably damaging 0.98
IGL03017:Cul5 APN 9 53644485 critical splice donor site probably null
IGL03031:Cul5 APN 9 53642675 splice site probably benign
IGL03196:Cul5 APN 9 53625880 missense probably damaging 0.99
R0142:Cul5 UTSW 9 53635050 missense probably damaging 0.98
R0415:Cul5 UTSW 9 53667070 missense probably benign 0.00
R1619:Cul5 UTSW 9 53658593 missense probably benign 0.00
R1675:Cul5 UTSW 9 53646683 missense probably benign 0.00
R2031:Cul5 UTSW 9 53667180 missense probably benign
R2059:Cul5 UTSW 9 53667156 missense probably damaging 0.98
R3427:Cul5 UTSW 9 53617890 missense probably benign
R3701:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3702:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3815:Cul5 UTSW 9 53622943 missense probably benign 0.31
R3848:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3849:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3850:Cul5 UTSW 9 53617986 missense probably benign 0.34
R4592:Cul5 UTSW 9 53633727 splice site probably benign
R4690:Cul5 UTSW 9 53622871 missense probably damaging 1.00
R5154:Cul5 UTSW 9 53625867 missense probably damaging 1.00
R5173:Cul5 UTSW 9 53642734 missense probably benign
R5645:Cul5 UTSW 9 53622943 missense probably benign 0.17
R5868:Cul5 UTSW 9 53658673 missense probably benign 0.26
R5975:Cul5 UTSW 9 53622793 missense probably damaging 1.00
R6251:Cul5 UTSW 9 53646794 missense probably benign 0.40
R6284:Cul5 UTSW 9 53623735 missense probably damaging 1.00
R6415:Cul5 UTSW 9 53646683 missense probably benign 0.00
R7178:Cul5 UTSW 9 53644526 missense probably benign 0.01
R7511:Cul5 UTSW 9 53625969 missense probably damaging 1.00
X0018:Cul5 UTSW 9 53622929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAACCCAGAAGAGCATTTC -3'
(R):5'- GGGATTGCCTTAAAGTAAAGCTG -3'

Sequencing Primer
(F):5'- TGTTCTGAAATCCTCTACAGACCAGG -3'
(R):5'- TGCCTTAAAGTAAAGCTGTATGTTG -3'
Posted On2015-01-23