Incidental Mutation 'R3401:Trim25'
ID259197
Institutional Source Beutler Lab
Gene Symbol Trim25
Ensembl Gene ENSMUSG00000000275
Gene Nametripartite motif-containing 25
Synonymsestrogen-responsive finger protein, Zfp147
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88999376-89020293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89010881 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 334 (M334T)
Ref Sequence ENSEMBL: ENSMUSP00000103528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000284] [ENSMUST00000100627] [ENSMUST00000107896]
PDB Structure
PRY-SPRY domain of Trim25 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000000284
AA Change: M334T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000284
Gene: ENSMUSG00000000275
AA Change: M334T

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 5e-34 BLAST
PDB:4LTB|B 189 380 7e-69 PDB
PRY 453 505 3.44e-17 SMART
SPRY 506 626 9.62e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100627
AA Change: M334T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098192
Gene: ENSMUSG00000000275
AA Change: M334T

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:BBOX 151 186 3e-8 BLAST
Blast:SPEC 189 288 2e-37 BLAST
PDB:4LTB|B 189 380 2e-71 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107896
AA Change: M334T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103528
Gene: ENSMUSG00000000275
AA Change: M334T

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 3e-34 BLAST
PDB:4LTB|B 189 380 8e-69 PDB
low complexity region 382 393 N/A INTRINSIC
PRY 461 513 3.44e-17 SMART
SPRY 514 634 9.62e-31 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations result in a compromised response to estrogen resulting in functional but small uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Trim25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Trim25 APN 11 88999691 missense probably damaging 0.96
IGL02398:Trim25 APN 11 88999804 missense probably damaging 1.00
IGL03150:Trim25 APN 11 89000005 missense probably damaging 1.00
R0003:Trim25 UTSW 11 89015772 missense probably benign 0.01
R0184:Trim25 UTSW 11 88999640 missense probably damaging 1.00
R0707:Trim25 UTSW 11 88999738 missense probably benign 0.03
R1855:Trim25 UTSW 11 89015581 missense probably benign 0.04
R1936:Trim25 UTSW 11 89004750 missense probably benign 0.03
R2229:Trim25 UTSW 11 89016621 missense probably damaging 0.97
R5159:Trim25 UTSW 11 88999532 missense probably benign 0.20
R5378:Trim25 UTSW 11 89009267 missense probably damaging 1.00
R6149:Trim25 UTSW 11 89015536 missense probably benign 0.00
R6867:Trim25 UTSW 11 89010887 missense probably benign 0.00
R6996:Trim25 UTSW 11 88999503 missense probably benign 0.00
R7055:Trim25 UTSW 11 88999924 missense probably benign
R7310:Trim25 UTSW 11 89015782 missense probably benign 0.03
R7451:Trim25 UTSW 11 89015737 missense possibly damaging 0.76
R7632:Trim25 UTSW 11 89015776 missense probably null 0.91
R7767:Trim25 UTSW 11 89009117 critical splice acceptor site probably null
X0022:Trim25 UTSW 11 89015596 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAAACCTTGGCCGTGTGATTG -3'
(R):5'- CAAAGCAGAGACGGTTTCAG -3'

Sequencing Primer
(F):5'- CTGTTGCCATAGGAACCATCAGTG -3'
(R):5'- GACGGTTTCAGGACCCTTGAAATTC -3'
Posted On2015-01-23