Incidental Mutation 'R3401:Sntg2'
ID259198
Institutional Source Beutler Lab
Gene Symbol Sntg2
Ensembl Gene ENSMUSG00000020672
Gene Namesyntrophin, gamma 2
Synonyms2210008K22Rik
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location30174482-30373375 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 30288172 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021004] [ENSMUST00000133324] [ENSMUST00000142046] [ENSMUST00000149710]
Predicted Effect probably benign
Transcript: ENSMUST00000021004
SMART Domains Protein: ENSMUSP00000021004
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
PH 297 423 7.66e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133324
SMART Domains Protein: ENSMUSP00000114245
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 70 9e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142046
SMART Domains Protein: ENSMUSP00000115942
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 89 1e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149710
SMART Domains Protein: ENSMUSP00000123332
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156953
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that bind to components of mechanosenstive sodium channels and the extreme carboxy-terminal domain of dystrophin and dystrophin-related proteins. The PDZ domain of this protein product interacts with a protein component of a mechanosensitive sodium channel that affects channel gating. Absence or reduction of this protein product has been associated with Duchenne muscular dystrophy. There is evidence of alternative splicing yet the full-length nature of these variants has not been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Eif1ad T C 19: 5,368,248 V20A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Sntg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sntg2 APN 12 30276721 missense probably benign 0.08
IGL00914:Sntg2 APN 12 30257957 intron probably benign
IGL00950:Sntg2 APN 12 30312681 splice site probably benign
IGL01106:Sntg2 APN 12 30257988 nonsense probably null
IGL01732:Sntg2 APN 12 30312649 missense probably damaging 0.99
IGL01987:Sntg2 APN 12 30312570 missense probably damaging 1.00
IGL02138:Sntg2 APN 12 30307231 critical splice acceptor site probably null
IGL02325:Sntg2 APN 12 30195543 missense probably benign 0.08
IGL02619:Sntg2 APN 12 30267026 splice site probably null
IGL02797:Sntg2 APN 12 30226892 missense possibly damaging 0.93
IGL03176:Sntg2 APN 12 30267023 splice site probably benign
PIT4445001:Sntg2 UTSW 12 30312572 missense probably damaging 1.00
R0126:Sntg2 UTSW 12 30201261 splice site probably benign
R0309:Sntg2 UTSW 12 30226773 missense probably benign 0.03
R0614:Sntg2 UTSW 12 30257978 missense possibly damaging 0.87
R1267:Sntg2 UTSW 12 30245128 missense probably benign 0.42
R1546:Sntg2 UTSW 12 30288296 missense probably damaging 1.00
R1696:Sntg2 UTSW 12 30267063 missense probably damaging 1.00
R1708:Sntg2 UTSW 12 30373180 missense possibly damaging 0.81
R1867:Sntg2 UTSW 12 30236651 missense probably benign
R2256:Sntg2 UTSW 12 30236688 nonsense probably null
R2895:Sntg2 UTSW 12 30226846 missense probably benign 0.00
R3522:Sntg2 UTSW 12 30312567 missense probably damaging 0.99
R4771:Sntg2 UTSW 12 30276659 splice site probably null
R4814:Sntg2 UTSW 12 30373268 unclassified probably benign
R5554:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R6056:Sntg2 UTSW 12 30312561 missense probably benign 0.06
R6328:Sntg2 UTSW 12 30258014 missense probably damaging 1.00
R6373:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R7314:Sntg2 UTSW 12 30267108 missense probably benign 0.01
R7494:Sntg2 UTSW 12 30229634 missense possibly damaging 0.89
R7571:Sntg2 UTSW 12 30175202 missense probably damaging 0.99
R7749:Sntg2 UTSW 12 30226911 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGCGAAATCAGATGTATTTCC -3'
(R):5'- GGTTGCCAAGATCCCCTTAAC -3'

Sequencing Primer
(F):5'- CCTTCAGTGCTTGTGGAGACC -3'
(R):5'- CAAGATCCCCTTAACAATGTTGCTG -3'
Posted On2015-01-23