Incidental Mutation 'R3401:Eif1ad'
ID259207
Institutional Source Beutler Lab
Gene Symbol Eif1ad
Ensembl Gene ENSMUSG00000024841
Gene Nameeukaryotic translation initiation factor 1A domain containing
Synonyms
MMRRC Submission 040620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3401 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5366813-5371511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5368248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000025759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025759] [ENSMUST00000025762] [ENSMUST00000170010]
Predicted Effect probably benign
Transcript: ENSMUST00000025759
AA Change: V20A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025759
Gene: ENSMUSG00000024841
AA Change: V20A

DomainStartEndE-ValueType
eIF1a 20 103 1.03e-40 SMART
low complexity region 131 142 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025762
SMART Domains Protein: ENSMUSP00000025762
Gene: ENSMUSG00000024844

DomainStartEndE-ValueType
BAF 1 88 3.68e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170010
SMART Domains Protein: ENSMUSP00000126202
Gene: ENSMUSG00000024844

DomainStartEndE-ValueType
BAF 1 88 3.68e-59 SMART
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B3gat1 C A 9: 26,755,853 T127K probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Cul5 A T 9: 53,621,212 M747K probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Faim2 C T 15: 99,520,348 V119I probably damaging Het
Fli1 G A 9: 32,461,274 S156L probably damaging Het
Gucy1a2 T A 9: 3,635,154 D399E probably benign Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Htr2a T C 14: 74,645,059 S162P probably damaging Het
Naip5 G A 13: 100,221,903 Q942* probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Pkd2 A G 5: 104,480,327 I422M possibly damaging Het
Polr3b C T 10: 84,699,491 T888M probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Ralgapa1 T C 12: 55,659,137 T2323A possibly damaging Het
Sntg2 A G 12: 30,288,172 probably benign Het
Stard9 A G 2: 120,703,689 I3476V probably damaging Het
Tead2 T A 7: 45,223,673 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Trim25 T C 11: 89,010,881 M334T probably benign Het
Uprt A G X: 104,506,258 D310G probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp157 T A 5: 138,457,011 N490K probably benign Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Eif1ad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Eif1ad APN 19 5368184 unclassified probably benign
IGL02012:Eif1ad APN 19 5368659 missense probably damaging 1.00
IGL02541:Eif1ad APN 19 5368417 unclassified probably benign
R0699:Eif1ad UTSW 19 5368698 missense possibly damaging 0.92
R1238:Eif1ad UTSW 19 5370083 makesense probably null
R1921:Eif1ad UTSW 19 5370058 unclassified probably benign
R2242:Eif1ad UTSW 19 5370058 unclassified probably benign
R4671:Eif1ad UTSW 19 5368191 start codon destroyed probably null 1.00
R7667:Eif1ad UTSW 19 5368215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAACAGGGCGAGGTGGC -3'
(R):5'- TGCAGATTGTTCCCAGGAG -3'

Sequencing Primer
(F):5'- GCACTTTTTCGTATAAGGCTGC -3'
(R):5'- AGCGAGAACTAGCCACTT -3'
Posted On2015-01-23