Incidental Mutation 'R3402:Stk3'
ID259239
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Nameserine/threonine kinase 3
Synonymsmess1, MST, Mst2
MMRRC Submission 040621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3402 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location34875496-35178921 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 34944998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]
Predicted Effect probably benign
Transcript: ENSMUST00000018476
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067033
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226555
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 A T 5: 89,701,733 F609L probably benign Het
Adgrv1 T C 13: 81,543,542 N1642S probably damaging Het
Afdn C T 17: 13,883,914 R1156C probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Col12a1 T C 9: 79,643,947 E2129G probably damaging Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Etl4 A T 2: 20,781,882 H763L probably damaging Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Hspb11 A G 4: 107,273,606 probably null Het
Kat2b C T 17: 53,665,853 P732S probably damaging Het
Myo16 A G 8: 10,384,719 N387S probably benign Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Olfr1378 A G 11: 50,969,068 I17V probably benign Het
Olfr1477 G A 19: 13,502,948 A202T probably benign Het
Pkn1 G A 8: 83,670,230 R926W probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Prkcq A G 2: 11,283,849 T538A possibly damaging Het
Rnf165 A G 18: 77,565,086 V6A probably benign Het
Sel1l2 T A 2: 140,241,038 Y560F probably damaging Het
Slc6a6 A G 6: 91,726,129 H161R probably benign Het
Slit2 T C 5: 48,283,421 Y1212H probably damaging Het
Tcaf3 T C 6: 42,593,853 S322G probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Unc80 A T 1: 66,510,686 E701V probably damaging Het
Upk3a T C 15: 85,018,183 probably null Het
Zfp180 G A 7: 24,105,745 V530I probably benign Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTCTGCTGCTAGTACAATTC -3'
(R):5'- GTGTTAGAACTTATACCTGCCTTCTG -3'

Sequencing Primer
(F):5'- GTCTGCTGCTAGTACAATTCTATAAG -3'
(R):5'- TCCCTAAGGAAATGCAACGTC -3'
Posted On2015-01-23