Incidental Mutation 'R3402:Kat2b'
ID259243
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission 040621-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3402 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53665853 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 732 (P732S)
Ref Sequence ENSEMBL: ENSMUSP00000000724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000166525]
Predicted Effect probably damaging
Transcript: ENSMUST00000000724
AA Change: P732S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708
AA Change: P732S

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167092
Predicted Effect probably benign
Transcript: ENSMUST00000171072
SMART Domains Protein: ENSMUSP00000127807
Gene: ENSMUSG00000000708

DomainStartEndE-ValueType
SCOP:d1qsta_ 2 48 6e-26 SMART
PDB:1CM0|A 2 50 1e-28 PDB
low complexity region 54 70 N/A INTRINSIC
Blast:BROMO 71 98 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172160
Meta Mutation Damage Score 0.6860 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 A T 5: 89,701,733 F609L probably benign Het
Adgrv1 T C 13: 81,543,542 N1642S probably damaging Het
Afdn C T 17: 13,883,914 R1156C probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Col12a1 T C 9: 79,643,947 E2129G probably damaging Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Etl4 A T 2: 20,781,882 H763L probably damaging Het
Hip1r A G 5: 123,996,983 E394G probably damaging Het
Hspb11 A G 4: 107,273,606 probably null Het
Myo16 A G 8: 10,384,719 N387S probably benign Het
Nlrp4d A T 7: 10,362,854 N906K probably damaging Het
Olfr1378 A G 11: 50,969,068 I17V probably benign Het
Olfr1477 G A 19: 13,502,948 A202T probably benign Het
Pkn1 G A 8: 83,670,230 R926W probably damaging Het
Ppp1r37 C T 7: 19,532,787 A392T probably damaging Het
Prkcq A G 2: 11,283,849 T538A possibly damaging Het
Rnf165 A G 18: 77,565,086 V6A probably benign Het
Sel1l2 T A 2: 140,241,038 Y560F probably damaging Het
Slc6a6 A G 6: 91,726,129 H161R probably benign Het
Slit2 T C 5: 48,283,421 Y1212H probably damaging Het
Stk3 G T 15: 34,944,998 probably benign Het
Tcaf3 T C 6: 42,593,853 S322G probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem74 C T 15: 43,867,021 V209M probably damaging Het
Unc80 A T 1: 66,510,686 E701V probably damaging Het
Upk3a T C 15: 85,018,183 probably null Het
Zfp180 G A 7: 24,105,745 V530I probably benign Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GACCCTGAGCAGCTTTACAG -3'
(R):5'- GCACAGAACGTCCCTGAATG -3'

Sequencing Primer
(F):5'- GCTTTACAGCACCCTCAAGAACATC -3'
(R):5'- GTCCCTGAATGAAACCCACTTC -3'
Posted On2015-01-23