Incidental Mutation 'R3403:Tmem74'
ID259260
Institutional Source Beutler Lab
Gene Symbol Tmem74
Ensembl Gene ENSMUSG00000054409
Gene Nametransmembrane protein 74
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3403 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location43864646-43870036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43867021 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 209 (V209M)
Ref Sequence ENSEMBL: ENSMUSP00000070748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067469]
Predicted Effect probably damaging
Transcript: ENSMUST00000067469
AA Change: V209M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070748
Gene: ENSMUSG00000054409
AA Change: V209M

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
Pfam:Neurensin 147 269 1.1e-12 PFAM
Meta Mutation Damage Score 0.6884 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T C 1: 78,696,122 V333A probably damaging Het
Afdn C T 17: 13,883,914 R1156C probably damaging Het
Asic3 A G 5: 24,416,987 E415G probably damaging Het
Cactin G A 10: 81,325,875 R747H probably benign Het
Calcr T A 6: 3,687,604 I465F probably benign Het
Dennd4c C T 4: 86,774,543 P97S probably damaging Het
Dnah3 A G 7: 119,967,656 V2449A probably benign Het
Dsg1c A G 18: 20,270,350 N189D probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ndrg3 C T 2: 156,948,288 V92M probably damaging Het
Olfr202 G C 16: 59,284,112 N128K probably benign Het
Pacs2 T C 12: 113,050,950 S214P probably damaging Het
Rad51 T A 2: 119,120,544 probably benign Het
Rtn4 T C 11: 29,707,690 S499P probably benign Het
Slc6a6 A G 6: 91,726,129 H161R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Unc80 A T 1: 66,510,686 E701V probably damaging Het
Upk3a T C 15: 85,018,183 probably null Het
Zhx1 T C 15: 58,054,349 E167G probably benign Het
Other mutations in Tmem74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Tmem74 APN 15 43867386 missense probably benign 0.05
IGL01985:Tmem74 APN 15 43867080 missense probably damaging 1.00
R1102:Tmem74 UTSW 15 43866790 missense probably benign 0.00
R1782:Tmem74 UTSW 15 43866952 missense probably damaging 1.00
R1851:Tmem74 UTSW 15 43867163 missense probably benign 0.29
R1852:Tmem74 UTSW 15 43867163 missense probably benign 0.29
R2352:Tmem74 UTSW 15 43867110 missense probably damaging 1.00
R3401:Tmem74 UTSW 15 43867021 missense probably damaging 1.00
R3402:Tmem74 UTSW 15 43867021 missense probably damaging 1.00
R4095:Tmem74 UTSW 15 43867282 nonsense probably null
R4607:Tmem74 UTSW 15 43867158 missense probably damaging 0.98
R4608:Tmem74 UTSW 15 43867158 missense probably damaging 0.98
R5218:Tmem74 UTSW 15 43867244 missense possibly damaging 0.52
R5304:Tmem74 UTSW 15 43866821 nonsense probably null
R5375:Tmem74 UTSW 15 43867168 missense possibly damaging 0.77
R6074:Tmem74 UTSW 15 43866738 missense possibly damaging 0.77
R7264:Tmem74 UTSW 15 43867468 missense probably benign 0.00
R7485:Tmem74 UTSW 15 43867365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAAATCTATTTCGACGATAGAG -3'
(R):5'- AGGTCACCATCAGCCAAAGG -3'

Sequencing Primer
(F):5'- ATTTCGACGATAGAGCTCTCC -3'
(R):5'- GGCAGTAATCACCCTGTAGATCTG -3'
Posted On2015-01-23