Incidental Mutation 'R3404:Ankar'
ID259268
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Nameankyrin and armadillo repeat containing
Synonyms4932422E22Rik
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location72642980-72700579 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 72643093 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1220 (K1220*)
Ref Sequence ENSEMBL: ENSMUSP00000148640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
Predicted Effect probably null
Transcript: ENSMUST00000053499
AA Change: K1438*
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: K1438*

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211837
AA Change: K1437*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212057
Predicted Effect probably null
Transcript: ENSMUST00000212573
AA Change: K1220*
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 intron probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCCATTCCCTGAAGATGCTG -3'
(R):5'- TACTTCCAGGGAAAGAGCACCG -3'

Sequencing Primer
(F):5'- CCTGAAGATGCTGTGTATTTTACCAC -3'
(R):5'- ACCAAGAGATTCCCTGACTTTATTAC -3'
Posted On2015-01-23