Incidental Mutation 'R3404:Ubap2l'
ID259270
Institutional Source Beutler Lab
Gene Symbol Ubap2l
Ensembl Gene ENSMUSG00000042520
Gene Nameubiquitin-associated protein 2-like
SynonymsA430103N23Rik, NICE-4, 3110083O19Rik, 4932431F02Rik
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90000140-90052628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90038850 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 149 (E149G)
Ref Sequence ENSEMBL: ENSMUSP00000143254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000090908] [ENSMUST00000195995] [ENSMUST00000196633] [ENSMUST00000196843] [ENSMUST00000197903] [ENSMUST00000198322] [ENSMUST00000199834] [ENSMUST00000199929]
Predicted Effect probably damaging
Transcript: ENSMUST00000029553
AA Change: E149G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520
AA Change: E149G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064639
AA Change: E149G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520
AA Change: E149G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090908
AA Change: E149G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520
AA Change: E149G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195995
AA Change: E149G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520
AA Change: E149G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect probably benign
Transcript: ENSMUST00000196633
SMART Domains Protein: ENSMUSP00000143423
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 6.3e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196843
AA Change: E149G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520
AA Change: E149G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197903
SMART Domains Protein: ENSMUSP00000143519
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 81 7e-32 PDB
Blast:UBA 50 81 7e-16 BLAST
SCOP:d1efub3 51 81 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198282
Predicted Effect probably damaging
Transcript: ENSMUST00000198322
AA Change: E149G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520
AA Change: E149G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199016
Predicted Effect probably damaging
Transcript: ENSMUST00000199834
AA Change: E149G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520
AA Change: E149G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199929
SMART Domains Protein: ENSMUSP00000142488
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 57 2e-12 PDB
Meta Mutation Damage Score 0.7195 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased female body size and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Ubap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2l APN 3 90009256 nonsense probably null
IGL02606:Ubap2l APN 3 90038428 missense probably damaging 0.98
IGL02809:Ubap2l APN 3 90021246 missense probably damaging 1.00
Panhandle UTSW 3 90031376 splice site probably benign
plainview UTSW 3 90038850 missense probably damaging 1.00
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0128:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0130:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0502:Ubap2l UTSW 3 90009213 missense probably damaging 1.00
R0619:Ubap2l UTSW 3 90017220 missense probably benign 0.01
R0726:Ubap2l UTSW 3 90021246 missense probably damaging 1.00
R1023:Ubap2l UTSW 3 90047873 utr 5 prime probably benign
R1172:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1174:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1175:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1191:Ubap2l UTSW 3 90023575 missense probably damaging 1.00
R1432:Ubap2l UTSW 3 90019328 missense probably benign 0.11
R1582:Ubap2l UTSW 3 90034671 missense probably damaging 1.00
R1771:Ubap2l UTSW 3 90019231 missense probably damaging 1.00
R2058:Ubap2l UTSW 3 90031376 splice site probably benign
R2059:Ubap2l UTSW 3 90031376 splice site probably benign
R2081:Ubap2l UTSW 3 90038964 missense possibly damaging 0.92
R2408:Ubap2l UTSW 3 90009132 missense probably null 0.99
R3551:Ubap2l UTSW 3 90015451 missense unknown
R4132:Ubap2l UTSW 3 90009184 missense probably damaging 1.00
R4782:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R4798:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R5173:Ubap2l UTSW 3 90021030 missense possibly damaging 0.86
R5274:Ubap2l UTSW 3 90012730 missense probably damaging 1.00
R5387:Ubap2l UTSW 3 90006596 missense probably benign 0.10
R6548:Ubap2l UTSW 3 90023560 missense probably damaging 1.00
R6912:Ubap2l UTSW 3 90038848 missense possibly damaging 0.84
R6995:Ubap2l UTSW 3 90009241 missense probably damaging 0.98
R7039:Ubap2l UTSW 3 90002355 missense probably damaging 1.00
R7323:Ubap2l UTSW 3 90015406 missense unknown
R7512:Ubap2l UTSW 3 90010496 missense unknown
R7815:Ubap2l UTSW 3 90043764 nonsense probably null
R7975:Ubap2l UTSW 3 90038769 splice site probably null
R8200:Ubap2l UTSW 3 90023626 missense probably benign 0.34
R8291:Ubap2l UTSW 3 90008231 makesense probably null
R8424:Ubap2l UTSW 3 90021031 missense probably damaging 1.00
R8441:Ubap2l UTSW 3 90012700 missense unknown
Z1176:Ubap2l UTSW 3 90001817 critical splice donor site probably null
Z1176:Ubap2l UTSW 3 90019204 missense probably damaging 1.00
Z1186:Ubap2l UTSW 3 90009236 missense unknown
Z1191:Ubap2l UTSW 3 90009236 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACAGAGAGCTGAGTCAAGTAAC -3'
(R):5'- CTTTAGCATTCCTGGGAGATGG -3'

Sequencing Primer
(F):5'- CAGAGAGCTGAGTCAAGTAACTTTAC -3'
(R):5'- CATTCCTGGGAGATGGTTGGGAAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R3404003_Ubap2l_PCR_F: 5’- TCACAGAGAGCTGAGTCAAGTAAC-3’

R3404003_Ubap2l_PCR_R: 5’- CTTTAGCATTCCTGGGAGATGG-3’

 

Sequencing Primers

R3404003_Ubap2l_SEQ_F: 5’- CAGAGAGCTGAGTCAAGTAACTTTAC-3’
 

R3404003_Ubap2l_SEQ_R: 5’- CATTCCTGGGAGATGGTTGGGAAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 405 nucleotides is amplified (NCBI RefSeq: NC_000069, chromosome 3):

 

tcacagagag ctgagtcaag taactttaca aatgactaca tgattgtcat ataagtgact       

actgtaggaa aggctacatg taaaagatgt caaggtctta acagatgatg gcaagaaatg      

caaataggtg atataatggt tacaggggcc tgcctagcag gatcctgaca catgcctgaa      

gtccagacat tactaaccca cagctggttt tgataaagcc ccatgcatac actctcgtcc      

acggctggca cctctccccc gtcttggtgg cccaccacgt cgccgactat agtctctgtc      

ccggtctcga ttttcttttc cttcttcatt agattcagtt tgtccaccat ccttttgtcc      

tgagactcct ttcttcttcc caaccatctc ccaggaatgc taaag

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, T>C; sense strand, A>G).

Posted On2015-01-23