Incidental Mutation 'R3404:Dnaic1'
ID259272
Institutional Source Beutler Lab
Gene Symbol Dnaic1
Ensembl Gene ENSMUSG00000061322
Gene Namedynein, axonemal, intermediate chain 1
Synonyms
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41569775-41638158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41603246 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 176 (E176D)
Ref Sequence ENSEMBL: ENSMUSP00000100028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102963]
Predicted Effect probably benign
Transcript: ENSMUST00000102963
AA Change: E176D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: E176D

DomainStartEndE-ValueType
low complexity region 134 158 N/A INTRINSIC
low complexity region 238 261 N/A INTRINSIC
Blast:WD40 319 370 1e-17 BLAST
WD40 374 413 1.5e-3 SMART
WD40 419 465 4.4e-2 SMART
Blast:WD40 493 526 5e-13 BLAST
WD40 530 570 9.3e-9 SMART
WD40 575 612 6e-3 SMART
WD40 623 659 1.4e0 SMART
Meta Mutation Damage Score 0.0658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Dnaic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Dnaic1 APN 4 41602917 missense probably benign 0.03
IGL02825:Dnaic1 APN 4 41625101 splice site probably benign
IGL03072:Dnaic1 APN 4 41602979 missense probably benign 0.00
H8562:Dnaic1 UTSW 4 41629833 missense possibly damaging 0.81
R0114:Dnaic1 UTSW 4 41605686 splice site probably benign
R0138:Dnaic1 UTSW 4 41629814 missense possibly damaging 0.49
R0153:Dnaic1 UTSW 4 41635162 unclassified probably benign
R0465:Dnaic1 UTSW 4 41629988 splice site probably null
R0550:Dnaic1 UTSW 4 41596274 nonsense probably null
R0555:Dnaic1 UTSW 4 41625335 missense possibly damaging 0.64
R0890:Dnaic1 UTSW 4 41604253 missense possibly damaging 0.69
R0928:Dnaic1 UTSW 4 41602566 missense possibly damaging 0.57
R0944:Dnaic1 UTSW 4 41629997 missense probably benign
R1714:Dnaic1 UTSW 4 41632164 missense probably benign 0.12
R1902:Dnaic1 UTSW 4 41625319 nonsense probably null
R1919:Dnaic1 UTSW 4 41570020 critical splice donor site probably null
R1983:Dnaic1 UTSW 4 41603232 missense probably benign
R2036:Dnaic1 UTSW 4 41632225 missense probably damaging 1.00
R2306:Dnaic1 UTSW 4 41625239 missense probably benign
R2925:Dnaic1 UTSW 4 41597919 missense probably damaging 1.00
R3720:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3721:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3722:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3931:Dnaic1 UTSW 4 41604229 missense probably damaging 1.00
R4330:Dnaic1 UTSW 4 41637966 missense probably damaging 1.00
R4755:Dnaic1 UTSW 4 41610269 missense probably damaging 0.99
R4905:Dnaic1 UTSW 4 41614269 missense probably benign 0.05
R4997:Dnaic1 UTSW 4 41597919 missense possibly damaging 0.80
R5088:Dnaic1 UTSW 4 41597630 missense probably benign 0.00
R5088:Dnaic1 UTSW 4 41632251 missense probably benign 0.02
R5970:Dnaic1 UTSW 4 41625281 missense probably benign 0.14
R5987:Dnaic1 UTSW 4 41632391 missense probably benign 0.03
R6247:Dnaic1 UTSW 4 41605775 missense probably benign
R6727:Dnaic1 UTSW 4 41625308 missense probably benign
R6874:Dnaic1 UTSW 4 41632412 missense probably damaging 1.00
R6914:Dnaic1 UTSW 4 41625176 missense probably benign 0.01
R7508:Dnaic1 UTSW 4 41614323 missense probably benign 0.01
R7831:Dnaic1 UTSW 4 41614695 critical splice donor site probably null
R7832:Dnaic1 UTSW 4 41605823 missense probably benign 0.42
R7985:Dnaic1 UTSW 4 41630055 missense probably benign
R8065:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
R8067:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
R8234:Dnaic1 UTSW 4 41625221 missense probably benign 0.00
X0065:Dnaic1 UTSW 4 41629868 missense possibly damaging 0.89
Z1176:Dnaic1 UTSW 4 41614323 missense probably benign 0.32
Z1177:Dnaic1 UTSW 4 41569809 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTCCCTGCCATTGAGATAAGC -3'
(R):5'- ACAAGCAAGAACTGATCTCGGG -3'

Sequencing Primer
(F):5'- CCTGCCATTGAGATAAGCTGTGG -3'
(R):5'- ATCTCGGGCCCGTGTCTAC -3'
Posted On2015-01-23