Incidental Mutation 'R3404:Bnc2'
ID259273
Institutional Source Beutler Lab
Gene Symbol Bnc2
Ensembl Gene ENSMUSG00000028487
Gene Namebasonuclin 2
Synonyms
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location84275095-84675275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84546241 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 20 (N20K)
Ref Sequence ENSEMBL: ENSMUSP00000134953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102820] [ENSMUST00000107198] [ENSMUST00000175756] [ENSMUST00000175800] [ENSMUST00000175969] [ENSMUST00000176346] [ENSMUST00000176370] [ENSMUST00000176418] [ENSMUST00000176612] [ENSMUST00000176691] [ENSMUST00000176947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102820
AA Change: N98K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099884
Gene: ENSMUSG00000028487
AA Change: N98K

DomainStartEndE-ValueType
low complexity region 362 378 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 469 492 4.72e-2 SMART
ZnF_C2H2 497 526 7.11e0 SMART
low complexity region 612 629 N/A INTRINSIC
low complexity region 633 642 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
ZnF_C2H2 861 884 1.62e0 SMART
ZnF_C2H2 889 916 4.81e0 SMART
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1048 1062 N/A INTRINSIC
ZnF_C2H2 1063 1086 1.03e-2 SMART
ZnF_C2H2 1091 1118 3.78e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107198
AA Change: N98K

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102816
Gene: ENSMUSG00000028487
AA Change: N98K

DomainStartEndE-ValueType
low complexity region 334 350 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
ZnF_C2H2 441 464 4.72e-2 SMART
ZnF_C2H2 469 498 7.11e0 SMART
low complexity region 584 601 N/A INTRINSIC
low complexity region 605 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
ZnF_C2H2 833 856 1.62e0 SMART
ZnF_C2H2 861 888 4.81e0 SMART
low complexity region 963 980 N/A INTRINSIC
low complexity region 1020 1034 N/A INTRINSIC
ZnF_C2H2 1035 1058 1.03e-2 SMART
ZnF_C2H2 1063 1090 3.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123276
Predicted Effect probably benign
Transcript: ENSMUST00000175756
Predicted Effect probably benign
Transcript: ENSMUST00000175800
AA Change: N20K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134795
Gene: ENSMUSG00000028487
AA Change: N20K

DomainStartEndE-ValueType
low complexity region 256 272 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175969
Predicted Effect probably benign
Transcript: ENSMUST00000176346
SMART Domains Protein: ENSMUSP00000134942
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176370
AA Change: N20K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000176418
AA Change: N98K
SMART Domains Protein: ENSMUSP00000135569
Gene: ENSMUSG00000028487
AA Change: N98K

DomainStartEndE-ValueType
low complexity region 367 383 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176612
AA Change: N56K

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135778
Gene: ENSMUSG00000028487
AA Change: N56K

DomainStartEndE-ValueType
low complexity region 292 308 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
ZnF_C2H2 399 422 4.72e-2 SMART
ZnF_C2H2 427 456 7.11e0 SMART
low complexity region 542 559 N/A INTRINSIC
low complexity region 563 572 N/A INTRINSIC
low complexity region 606 620 N/A INTRINSIC
ZnF_C2H2 791 814 1.62e0 SMART
low complexity region 832 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176691
SMART Domains Protein: ENSMUSP00000135375
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 374 397 4.72e-2 SMART
ZnF_C2H2 402 431 7.11e0 SMART
low complexity region 517 534 N/A INTRINSIC
low complexity region 538 547 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
ZnF_C2H2 766 789 1.62e0 SMART
ZnF_C2H2 794 821 4.81e0 SMART
low complexity region 896 913 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
ZnF_C2H2 968 991 1.03e-2 SMART
ZnF_C2H2 996 1023 3.78e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176947
AA Change: N56K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177256
Predicted Effect unknown
Transcript: ENSMUST00000177040
AA Change: N16K
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved zinc finger protein. The encoded protein functions in skin color saturation. Mutations in this gene are associated with facial pigmented spots. This gene is also associated with susceptibility to adolescent idiopathic scoliosis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap insertion die within 24 hrs of birth and display cleft palate, an overall size reduction of the head and tongue, and abnormal craniofacial bone development due to impaired multiplication of embryonic craniofacial mesenchymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Bnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Bnc2 APN 4 84276241 splice site probably null
IGL01902:Bnc2 APN 4 84390944 missense probably damaging 1.00
IGL02228:Bnc2 APN 4 84293076 missense possibly damaging 0.70
IGL02396:Bnc2 APN 4 84276009 missense probably benign 0.16
R0125:Bnc2 UTSW 4 84292932 missense probably damaging 1.00
R0650:Bnc2 UTSW 4 84293196 missense probably benign 0.04
R1082:Bnc2 UTSW 4 84546335 missense probably damaging 1.00
R1334:Bnc2 UTSW 4 84276289 missense possibly damaging 0.49
R1439:Bnc2 UTSW 4 84276068 missense probably benign 0.38
R1447:Bnc2 UTSW 4 84293220 missense probably benign 0.13
R1515:Bnc2 UTSW 4 84414326 missense probably null 0.99
R1548:Bnc2 UTSW 4 84275957 missense probably damaging 1.00
R1818:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R1819:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R2345:Bnc2 UTSW 4 84292503 missense probably damaging 1.00
R2897:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2898:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2966:Bnc2 UTSW 4 84293517 missense probably benign 0.14
R4235:Bnc2 UTSW 4 84293514 missense probably damaging 0.96
R4546:Bnc2 UTSW 4 84291976 missense probably benign 0.34
R4676:Bnc2 UTSW 4 84292819 missense probably damaging 1.00
R4926:Bnc2 UTSW 4 84276179 missense probably damaging 1.00
R5060:Bnc2 UTSW 4 84531635 missense probably benign 0.02
R5365:Bnc2 UTSW 4 84411429 intron probably benign
R5735:Bnc2 UTSW 4 84292671 missense probably damaging 1.00
R5872:Bnc2 UTSW 4 84292770 missense possibly damaging 0.86
R5921:Bnc2 UTSW 4 84293055 missense possibly damaging 0.95
R5999:Bnc2 UTSW 4 84555900 missense probably benign 0.20
R6351:Bnc2 UTSW 4 84293143 missense probably benign 0.16
R6869:Bnc2 UTSW 4 84293496 missense probably damaging 1.00
R7236:Bnc2 UTSW 4 84555864 missense probably benign 0.31
R7363:Bnc2 UTSW 4 84292071 missense probably benign 0.02
R7643:Bnc2 UTSW 4 84506574 missense probably benign 0.01
R8017:Bnc2 UTSW 4 84411425 missense
R8019:Bnc2 UTSW 4 84411425 missense
R8050:Bnc2 UTSW 4 84292336 missense probably benign 0.00
R8311:Bnc2 UTSW 4 84276345 missense possibly damaging 0.69
R8463:Bnc2 UTSW 4 84293371 missense probably damaging 0.99
R8676:Bnc2 UTSW 4 84276313 missense possibly damaging 0.65
R8722:Bnc2 UTSW 4 84293646 missense possibly damaging 0.92
R8845:Bnc2 UTSW 4 84276101 missense possibly damaging 0.81
X0021:Bnc2 UTSW 4 84293140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGAAGTAACACTGCAC -3'
(R):5'- GTATACTCCTGCTACTGGCTGC -3'

Sequencing Primer
(F):5'- GGAAGTAACACTGCACAATCCAGTAG -3'
(R):5'- TACTGGCTGCCAAGAAGCTC -3'
Posted On2015-01-23