Incidental Mutation 'R3404:Pzp'
ID259278
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene NamePZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128483567-128526720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128513806 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 398 (T398M)
Ref Sequence ENSEMBL: ENSMUSP00000107760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132]
Predicted Effect probably damaging
Transcript: ENSMUST00000032510
AA Change: T398M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032510
Gene: ENSMUSG00000030359
AA Change: T398M

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 8.8e-22 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1002 5.7e-19 PFAM
Pfam:A2M_comp 1022 1284 1.6e-93 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112132
AA Change: T398M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: T398M

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128516909 missense probably benign 0.25
IGL01470:Pzp APN 6 128521124 missense probably benign 0.05
IGL01753:Pzp APN 6 128502183 missense possibly damaging 0.78
IGL01878:Pzp APN 6 128495298 missense probably damaging 1.00
IGL02307:Pzp APN 6 128489086 nonsense probably null
IGL02338:Pzp APN 6 128486170 missense probably benign 0.07
IGL02546:Pzp APN 6 128494699 splice site probably benign
IGL02598:Pzp APN 6 128487457 missense probably benign 0.00
IGL02699:Pzp APN 6 128487401 critical splice donor site probably null
P4748:Pzp UTSW 6 128490089 missense probably damaging 1.00
PIT4151001:Pzp UTSW 6 128525296 missense probably benign 0.34
PIT4495001:Pzp UTSW 6 128502229 missense probably benign
R0157:Pzp UTSW 6 128523976 nonsense probably null
R0195:Pzp UTSW 6 128487478 missense probably damaging 1.00
R0238:Pzp UTSW 6 128489156 splice site probably benign
R0239:Pzp UTSW 6 128489156 splice site probably benign
R0271:Pzp UTSW 6 128519514 missense probably damaging 1.00
R0299:Pzp UTSW 6 128495330 splice site probably benign
R0744:Pzp UTSW 6 128516195 unclassified probably benign
R0968:Pzp UTSW 6 128525145 missense probably benign 0.00
R1037:Pzp UTSW 6 128519426 missense probably benign 0.01
R1074:Pzp UTSW 6 128487924 missense probably benign 0.20
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1579:Pzp UTSW 6 128523968 critical splice donor site probably null
R1646:Pzp UTSW 6 128503555 missense probably benign 0.33
R1770:Pzp UTSW 6 128485617 missense probably damaging 1.00
R1777:Pzp UTSW 6 128490572 missense possibly damaging 0.85
R1786:Pzp UTSW 6 128491161 splice site probably null
R1854:Pzp UTSW 6 128502225 missense probably damaging 1.00
R2001:Pzp UTSW 6 128516120 missense probably benign 0.01
R2060:Pzp UTSW 6 128483710 missense probably benign 0.45
R2081:Pzp UTSW 6 128519420 missense probably benign 0.00
R2130:Pzp UTSW 6 128491161 splice site probably null
R2131:Pzp UTSW 6 128491161 splice site probably null
R2160:Pzp UTSW 6 128525276 missense probably damaging 1.00
R2168:Pzp UTSW 6 128488047 missense probably damaging 0.98
R2328:Pzp UTSW 6 128510390 missense possibly damaging 0.79
R2441:Pzp UTSW 6 128489768 nonsense probably null
R2866:Pzp UTSW 6 128525264 missense possibly damaging 0.76
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2873:Pzp UTSW 6 128485556 critical splice donor site probably null
R2876:Pzp UTSW 6 128491550 missense probably damaging 1.00
R4452:Pzp UTSW 6 128491240 missense probably damaging 1.00
R4461:Pzp UTSW 6 128524040 missense probably benign 0.02
R5103:Pzp UTSW 6 128502229 missense probably benign 0.04
R5193:Pzp UTSW 6 128502334 missense probably benign 0.00
R5425:Pzp UTSW 6 128489048 missense probably damaging 0.97
R5465:Pzp UTSW 6 128486961 missense probably damaging 1.00
R5590:Pzp UTSW 6 128523796 missense probably damaging 1.00
R5656:Pzp UTSW 6 128490072 missense probably damaging 0.99
R5697:Pzp UTSW 6 128525189 missense probably benign 0.03
R5854:Pzp UTSW 6 128506869 missense probably benign 0.01
R5994:Pzp UTSW 6 128491597 missense probably damaging 1.00
R6042:Pzp UTSW 6 128524014 missense possibly damaging 0.75
R6054:Pzp UTSW 6 128513764 missense probably benign 0.03
R6153:Pzp UTSW 6 128489016 missense probably benign
R6465:Pzp UTSW 6 128491619 missense probably damaging 1.00
R6719:Pzp UTSW 6 128524083 missense probably benign 0.17
R6722:Pzp UTSW 6 128487954 missense probably damaging 1.00
R7316:Pzp UTSW 6 128513773 missense probably damaging 0.99
R7453:Pzp UTSW 6 128486916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCCTGACACAGAACTTTC -3'
(R):5'- TCAGGAAAGGACAGGGTCTTTC -3'

Sequencing Primer
(F):5'- GTTCCCACATTGCTCAGTTTG -3'
(R):5'- GTCTTTCCTGAAGAGACAAAGATG -3'
Posted On2015-01-23