Mutagenetix > Incidental Mutations

Incidental Mutation 'R3404:Pzp'

259278

Institutional Source

Beutler Lab

Gene Symbol

Pzp

Ensembl Gene

ENSMUSG00000030359

Gene Name

PZP, alpha-2-macroglobulin like

Synonyms

MMRRC Submission

040622-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R3404 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128483567-128526720 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 128513806 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 398 (T398M)

Ref Sequence

ENSEMBL: ENSMUSP00000107760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112132]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032510
AA Change: T398M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032510
Gene: ENSMUSG00000030359
AA Change: T398M

Domain	Start	End	E-Value	Type
low complexity region	11	18	N/A	INTRINSIC
Pfam:A2M_N	126	219	8.8e-22	PFAM
low complexity region	327	338	N/A	INTRINSIC
A2M_N_2	458	606	6.18e-40	SMART
A2M	750	840	2.27e-38	SMART
Pfam:Thiol-ester_cl	973	1002	5.7e-19	PFAM
Pfam:A2M_comp	1022	1284	1.6e-93	PFAM
A2M_recep	1395	1482	6.47e-43	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112132
AA Change: T398M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: T398M

Domain	Start	End	E-Value	Type
low complexity region	11	18	N/A	INTRINSIC
Pfam:A2M_N	126	219	3.2e-23	PFAM
low complexity region	327	338	N/A	INTRINSIC
A2M_N_2	458	606	6.18e-40	SMART
A2M	750	840	2.27e-38	SMART
Pfam:Thiol-ester_cl	973	1003	4e-19	PFAM
Pfam:A2M_comp	1022	1284	2.1e-90	PFAM
A2M_recep	1395	1482	6.47e-43	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 93.8%

Validation Efficiency

98% (41/42)

MGI Phenotype

PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	C	T	15: 64,699,600	V1065M	probably damaging	Het
Alg12	A	T	15: 88,814,579	I181N	probably damaging	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Ankar	T	A	1: 72,643,093	K1220*	probably null	Het
Apc	A	G	18: 34,313,602	T1150A	probably benign	Het
Baz1a	C	T	12: 54,916,989	S770N	probably benign	Het
Bcorl1	T	A	X: 48,371,007	M1139K	probably benign	Het
Bdkrb2	T	C	12: 105,592,496	V332A	possibly damaging	Het
Bnc2	G	T	4: 84,546,241	N20K	probably damaging	Het
Brip1	T	A	11: 86,143,263	N544I	possibly damaging	Het
Cdc27	T	C	11: 104,507,200	E778G	probably damaging	Het
Cyp2c66	T	C	19: 39,163,327	V162A	probably benign	Het
Dnaic1	A	T	4: 41,603,246	E176D	probably benign	Het
Dnhd1	C	T	7: 105,694,761	Q1771*	probably null	Het
Fezf1	A	T	6: 23,247,284	V264D	probably benign	Het
Gsdma	T	C	11: 98,673,138		probably benign	Het
Hemk1	G	A	9: 107,337,216	Q6*	probably null	Het
Hspa13	C	A	16: 75,758,026	E391*	probably null	Het
Ighv1-53	T	A	12: 115,158,438	T106S	possibly damaging	Het
Immp2l	T	A	12: 41,110,847	L48*	probably null	Het
Itgam	A	G	7: 128,070,703		probably null	Het
Ltn1	A	T	16: 87,416,215	V486D	probably damaging	Het
Mki67	T	A	7: 135,707,475	T416S	probably benign	Het
Mycbp2	C	A	14: 103,200,114	C2104F	probably damaging	Het
Nlrp2	T	C	7: 5,319,287	D49G	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pcdh17	T	A	14: 84,446,622	D176E	probably damaging	Het
Prkd1	C	T	12: 50,648,904	A24T	unknown	Het
Rbfox3	T	A	11: 118,496,457	Q277L	possibly damaging	Het
Rnf146	A	G	10: 29,347,428	V154A	possibly damaging	Het
Senp7	T	A	16: 56,188,277	W1007R	probably damaging	Het
Snx31	C	T	15: 36,525,653	C300Y	probably benign	Het
Ticrr	G	C	7: 79,694,791	S1468T	probably benign	Het
Trim33	A	G	3: 103,321,559	E327G	probably damaging	Het
Ubap2l	T	C	3: 90,038,850	E149G	probably damaging	Het
Ube4a	A	G	9: 44,929,687	S979P	probably damaging	Het
Uvssa	G	T	5: 33,389,818	G243C	probably damaging	Het
Vps13b	T	C	15: 35,926,054	S3834P	probably damaging	Het
Zfp609	A	T	9: 65,701,172	M1142K	possibly damaging	Het
Zfp729b	T	G	13: 67,591,164	H994P	probably damaging	Het

Other mutations in Pzp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Pzp	APN	6	128516909	missense	probably benign	0.25
IGL01470:Pzp	APN	6	128521124	missense	probably benign	0.05
IGL01753:Pzp	APN	6	128502183	missense	possibly damaging	0.78
IGL01878:Pzp	APN	6	128495298	missense	probably damaging	1.00
IGL02307:Pzp	APN	6	128489086	nonsense	probably null
IGL02338:Pzp	APN	6	128486170	missense	probably benign	0.07
IGL02546:Pzp	APN	6	128494699	splice site	probably benign
IGL02598:Pzp	APN	6	128487457	missense	probably benign	0.00
IGL02699:Pzp	APN	6	128487401	critical splice donor site	probably null
P4748:Pzp	UTSW	6	128490089	missense	probably damaging	1.00
PIT4151001:Pzp	UTSW	6	128525296	missense	probably benign	0.34
PIT4495001:Pzp	UTSW	6	128502229	missense	probably benign
R0157:Pzp	UTSW	6	128523976	nonsense	probably null
R0195:Pzp	UTSW	6	128487478	missense	probably damaging	1.00
R0238:Pzp	UTSW	6	128489156	splice site	probably benign
R0239:Pzp	UTSW	6	128489156	splice site	probably benign
R0271:Pzp	UTSW	6	128519514	missense	probably damaging	1.00
R0299:Pzp	UTSW	6	128495330	splice site	probably benign
R0744:Pzp	UTSW	6	128516195	unclassified	probably benign
R0968:Pzp	UTSW	6	128525145	missense	probably benign	0.00
R1037:Pzp	UTSW	6	128519426	missense	probably benign	0.01
R1074:Pzp	UTSW	6	128487924	missense	probably benign	0.20
R1469:Pzp	UTSW	6	128512356	missense	probably benign	0.04
R1469:Pzp	UTSW	6	128512356	missense	probably benign	0.04
R1579:Pzp	UTSW	6	128523968	critical splice donor site	probably null
R1646:Pzp	UTSW	6	128503555	missense	probably benign	0.33
R1770:Pzp	UTSW	6	128485617	missense	probably damaging	1.00
R1777:Pzp	UTSW	6	128490572	missense	possibly damaging	0.85
R1786:Pzp	UTSW	6	128491161	splice site	probably null
R1854:Pzp	UTSW	6	128502225	missense	probably damaging	1.00
R2001:Pzp	UTSW	6	128516120	missense	probably benign	0.01
R2060:Pzp	UTSW	6	128483710	missense	probably benign	0.45
R2081:Pzp	UTSW	6	128519420	missense	probably benign	0.00
R2130:Pzp	UTSW	6	128491161	splice site	probably null
R2131:Pzp	UTSW	6	128491161	splice site	probably null
R2160:Pzp	UTSW	6	128525276	missense	probably damaging	1.00
R2168:Pzp	UTSW	6	128488047	missense	probably damaging	0.98
R2328:Pzp	UTSW	6	128510390	missense	possibly damaging	0.79
R2441:Pzp	UTSW	6	128489768	nonsense	probably null
R2866:Pzp	UTSW	6	128525264	missense	possibly damaging	0.76
R2869:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2869:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2870:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2870:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2873:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2876:Pzp	UTSW	6	128491550	missense	probably damaging	1.00
R4452:Pzp	UTSW	6	128491240	missense	probably damaging	1.00
R4461:Pzp	UTSW	6	128524040	missense	probably benign	0.02
R5103:Pzp	UTSW	6	128502229	missense	probably benign	0.04
R5193:Pzp	UTSW	6	128502334	missense	probably benign	0.00
R5425:Pzp	UTSW	6	128489048	missense	probably damaging	0.97
R5465:Pzp	UTSW	6	128486961	missense	probably damaging	1.00
R5590:Pzp	UTSW	6	128523796	missense	probably damaging	1.00
R5656:Pzp	UTSW	6	128490072	missense	probably damaging	0.99
R5697:Pzp	UTSW	6	128525189	missense	probably benign	0.03
R5854:Pzp	UTSW	6	128506869	missense	probably benign	0.01
R5994:Pzp	UTSW	6	128491597	missense	probably damaging	1.00
R6042:Pzp	UTSW	6	128524014	missense	possibly damaging	0.75
R6054:Pzp	UTSW	6	128513764	missense	probably benign	0.03
R6153:Pzp	UTSW	6	128489016	missense	probably benign
R6465:Pzp	UTSW	6	128491619	missense	probably damaging	1.00
R6719:Pzp	UTSW	6	128524083	missense	probably benign	0.17
R6722:Pzp	UTSW	6	128487954	missense	probably damaging	1.00
R7316:Pzp	UTSW	6	128513773	missense	probably damaging	0.99
R7453:Pzp	UTSW	6	128486916	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCCTGACACAGAACTTTC -3'
(R):5'- TCAGGAAAGGACAGGGTCTTTC -3'

Sequencing Primer
(F):5'- GTTCCCACATTGCTCAGTTTG -3'
(R):5'- GTCTTTCCTGAAGAGACAAAGATG -3'

Posted On

2015-01-23