Incidental Mutation 'R3404:Nlrp2'
ID 259279
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
MMRRC Submission 040622-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3404 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5298547-5351035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5319287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000147102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
AlphaFold Q4PLS0
Predicted Effect probably benign
Transcript: ENSMUST00000045022
AA Change: D787G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: D787G

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207520
AA Change: D49G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000207685
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5327549 missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5327888 missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5324979 missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5322458 missense probably null 0.00
R9038:Nlrp2 UTSW 7 5327479 missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5327573 missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5301053 missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5319216 missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCAAAGCGATGTTCCATAGG -3'
(R):5'- TCAATTAGCTGCAGTCAGTTTCTG -3'

Sequencing Primer
(F):5'- TCCATAGGAAGAAAGGACATACTTAC -3'
(R):5'- AGTCAGTTTCTGCTATCTCTTTGTAG -3'
Posted On 2015-01-23