Incidental Mutation 'R3404:Hemk1'
ID259286
Institutional Source Beutler Lab
Gene Symbol Hemk1
Ensembl Gene ENSMUSG00000032579
Gene NameHemK methyltransferase family member 1
Synonyms2310008M14Rik
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107327084-107338350 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 107337216 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 6 (Q6*)
Ref Sequence ENSEMBL: ENSMUSP00000035196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035196] [ENSMUST00000042581] [ENSMUST00000118051]
Predicted Effect probably null
Transcript: ENSMUST00000035196
AA Change: Q6*
SMART Domains Protein: ENSMUSP00000035196
Gene: ENSMUSG00000032579
AA Change: Q6*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cons_hypoth95 114 267 9.9e-9 PFAM
Pfam:PrmA 137 265 4e-9 PFAM
Pfam:MTS 146 259 4.1e-13 PFAM
Pfam:Methyltransf_31 158 305 2.3e-14 PFAM
Pfam:Methyltransf_4 160 231 5.2e-7 PFAM
Pfam:Methyltransf_18 160 298 1.7e-11 PFAM
Pfam:Methyltransf_26 161 299 1.1e-10 PFAM
Pfam:Methyltransf_25 164 262 2.7e-9 PFAM
Pfam:Methyltransf_11 165 259 2.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042581
SMART Domains Protein: ENSMUSP00000047093
Gene: ENSMUSG00000037977

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118051
SMART Domains Protein: ENSMUSP00000112882
Gene: ENSMUSG00000032579

DomainStartEndE-ValueType
SCOP:d1g60a_ 9 82 9e-7 SMART
Blast:MeTrc 14 82 2e-6 BLAST
PDB:4DZR|A 15 118 2e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148165
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Hemk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Hemk1 APN 9 107330796 missense possibly damaging 0.89
IGL02164:Hemk1 APN 9 107331536 missense probably benign
IGL02811:Hemk1 APN 9 107331551 missense probably benign 0.01
R3406:Hemk1 UTSW 9 107337216 nonsense probably null
R3806:Hemk1 UTSW 9 107337030 missense probably damaging 0.99
R4277:Hemk1 UTSW 9 107328529 missense possibly damaging 0.95
R4820:Hemk1 UTSW 9 107328186 missense probably benign 0.18
R4857:Hemk1 UTSW 9 107329448 intron probably benign
R5172:Hemk1 UTSW 9 107329432 missense possibly damaging 0.84
R5615:Hemk1 UTSW 9 107330824 critical splice acceptor site probably null
R5624:Hemk1 UTSW 9 107331528 missense probably benign
R7372:Hemk1 UTSW 9 107337068 missense probably benign 0.01
R7468:Hemk1 UTSW 9 107331089 critical splice donor site probably null
R7524:Hemk1 UTSW 9 107328285 missense probably benign 0.27
R8851:Hemk1 UTSW 9 107336213 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTACTCACTGGATTCCCGG -3'
(R):5'- AAAAGCACACCCTTTCCTGG -3'

Sequencing Primer
(F):5'- TGGATTCCCGGGCCTCTG -3'
(R):5'- ACCCTTTCCTGGCACATTTTGAG -3'
Posted On2015-01-23