Incidental Mutation 'R3404:Rnf146'
ID259287
Institutional Source Beutler Lab
Gene Symbol Rnf146
Ensembl Gene ENSMUSG00000038876
Gene Namering finger protein 146
Synonyms2610509H23Rik, Iduna
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location29344176-29362442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29347428 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 154 (V154A)
Ref Sequence ENSEMBL: ENSMUSP00000124772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020034] [ENSMUST00000037548] [ENSMUST00000160144] [ENSMUST00000160372] [ENSMUST00000160399] [ENSMUST00000161508] [ENSMUST00000161605] [ENSMUST00000162335] [ENSMUST00000214896]
Predicted Effect probably benign
Transcript: ENSMUST00000020034
SMART Domains Protein: ENSMUSP00000020034
Gene: ENSMUSG00000019883

DomainStartEndE-ValueType
Pfam:ECH_1 74 307 4.8e-39 PFAM
Pfam:ECH_2 79 321 4.5e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037548
AA Change: V154A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037224
Gene: ENSMUSG00000038876
AA Change: V154A

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160144
AA Change: V154A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124288
Gene: ENSMUSG00000038876
AA Change: V154A

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160372
AA Change: V154A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124215
Gene: ENSMUSG00000038876
AA Change: V154A

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160399
SMART Domains Protein: ENSMUSP00000125553
Gene: ENSMUSG00000019883

DomainStartEndE-ValueType
Pfam:ECH 49 293 1.6e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161508
AA Change: V154A

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124814
Gene: ENSMUSG00000038876
AA Change: V154A

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161605
SMART Domains Protein: ENSMUSP00000125048
Gene: ENSMUSG00000019883

DomainStartEndE-ValueType
Pfam:ECH 49 165 4.4e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162335
AA Change: V154A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124772
Gene: ENSMUSG00000038876
AA Change: V154A

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178368
Predicted Effect possibly damaging
Transcript: ENSMUST00000214896
AA Change: V154A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215840
Meta Mutation Damage Score 0.1374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in immune cells exhibit osteopenia with enhanced osteoclastogenesis. Mice homozygous for a conditional allele activated in osteoblast exhibit ostepenia with impaired osteoblast numbers, increased adipogenesis and impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Rnf146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rnf146 APN 10 29347860 missense probably damaging 0.99
IGL02151:Rnf146 APN 10 29347353 missense probably damaging 1.00
R1024:Rnf146 UTSW 10 29347096 nonsense probably null
R1757:Rnf146 UTSW 10 29347479 missense probably damaging 0.99
R1844:Rnf146 UTSW 10 29347724 missense probably damaging 1.00
R1923:Rnf146 UTSW 10 29347719 missense probably damaging 1.00
R4060:Rnf146 UTSW 10 29347367 missense probably damaging 1.00
R5689:Rnf146 UTSW 10 29347804 missense probably benign
R6742:Rnf146 UTSW 10 29347532 missense probably damaging 1.00
R7459:Rnf146 UTSW 10 29347644 missense probably benign 0.08
R8126:Rnf146 UTSW 10 29347376 missense probably damaging 0.99
X0067:Rnf146 UTSW 10 29347788 missense probably benign 0.09
Z1088:Rnf146 UTSW 10 29347572 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGGCACTGCAAGCTGAAC -3'
(R):5'- AGCCAACCTTGTTGTCACC -3'

Sequencing Primer
(F):5'- CTGAACAGAAGCTCCAGTCTGTG -3'
(R):5'- TTGTCACCAGAAGAACTTAAGGCTG -3'
Posted On2015-01-23