Mutagenetix > Incidental Mutations

Incidental Mutation 'R3404:Brip1'

259288

Institutional Source

Beutler Lab

Gene Symbol

Brip1

Ensembl Gene

ENSMUSG00000034329

Gene Name

BRCA1 interacting protein C-terminal helicase 1

Synonyms

8030460J03Rik, 3110009N10Rik, BACH1

MMRRC Submission

040622-MU

Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3404 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86058138-86201193 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86143263 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 544 (N544I)

Ref Sequence

ENSEMBL: ENSMUSP00000043108 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044423]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044423
AA Change: N544I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: N544I

Domain	Start	End	E-Value	Type
DEXDc	17	520	1.4e-3	SMART
HELICc	701	854	8.2e-41	SMART

Meta Mutation Damage Score

0.3280

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 93.8%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	C	T	15: 64,699,600	V1065M	probably damaging	Het
Alg12	A	T	15: 88,814,579	I181N	probably damaging	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Ankar	T	A	1: 72,643,093	K1220*	probably null	Het
Apc	A	G	18: 34,313,602	T1150A	probably benign	Het
Baz1a	C	T	12: 54,916,989	S770N	probably benign	Het
Bcorl1	T	A	X: 48,371,007	M1139K	probably benign	Het
Bdkrb2	T	C	12: 105,592,496	V332A	possibly damaging	Het
Bnc2	G	T	4: 84,546,241	N20K	probably damaging	Het
Cdc27	T	C	11: 104,507,200	E778G	probably damaging	Het
Cyp2c66	T	C	19: 39,163,327	V162A	probably benign	Het
Dnaic1	A	T	4: 41,603,246	E176D	probably benign	Het
Dnhd1	C	T	7: 105,694,761	Q1771*	probably null	Het
Fezf1	A	T	6: 23,247,284	V264D	probably benign	Het
Gsdma	T	C	11: 98,673,138		probably benign	Het
Hemk1	G	A	9: 107,337,216	Q6*	probably null	Het
Hspa13	C	A	16: 75,758,026	E391*	probably null	Het
Ighv1-53	T	A	12: 115,158,438	T106S	possibly damaging	Het
Immp2l	T	A	12: 41,110,847	L48*	probably null	Het
Itgam	A	G	7: 128,070,703		probably null	Het
Ltn1	A	T	16: 87,416,215	V486D	probably damaging	Het
Mki67	T	A	7: 135,707,475	T416S	probably benign	Het
Mycbp2	C	A	14: 103,200,114	C2104F	probably damaging	Het
Nlrp2	T	C	7: 5,319,287	D49G	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pcdh17	T	A	14: 84,446,622	D176E	probably damaging	Het
Prkd1	C	T	12: 50,648,904	A24T	unknown	Het
Pzp	G	A	6: 128,513,806	T398M	probably damaging	Het
Rbfox3	T	A	11: 118,496,457	Q277L	possibly damaging	Het
Rnf146	A	G	10: 29,347,428	V154A	possibly damaging	Het
Senp7	T	A	16: 56,188,277	W1007R	probably damaging	Het
Snx31	C	T	15: 36,525,653	C300Y	probably benign	Het
Ticrr	G	C	7: 79,694,791	S1468T	probably benign	Het
Trim33	A	G	3: 103,321,559	E327G	probably damaging	Het
Ubap2l	T	C	3: 90,038,850	E149G	probably damaging	Het
Ube4a	A	G	9: 44,929,687	S979P	probably damaging	Het
Uvssa	G	T	5: 33,389,818	G243C	probably damaging	Het
Vps13b	T	C	15: 35,926,054	S3834P	probably damaging	Het
Zfp609	A	T	9: 65,701,172	M1142K	possibly damaging	Het
Zfp729b	T	G	13: 67,591,164	H994P	probably damaging	Het

Other mutations in Brip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Brip1	APN	11	86148401	missense	possibly damaging	0.53
IGL01098:Brip1	APN	11	86108862	missense	possibly damaging	0.71
IGL01503:Brip1	APN	11	86061877	missense	probably benign	0.33
IGL01602:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01605:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01940:Brip1	APN	11	86064966	missense	probably benign	0.00
IGL02019:Brip1	APN	11	86197949	missense	possibly damaging	0.73
IGL02212:Brip1	APN	11	86139015	missense	possibly damaging	0.86
IGL02456:Brip1	APN	11	86065099	missense	possibly damaging	0.71
IGL02727:Brip1	APN	11	86152736	missense	probably benign	0.02
IGL02983:Brip1	APN	11	86139124	missense	probably benign	0.03
IGL03022:Brip1	APN	11	86077950	missense	probably damaging	0.98
IGL03116:Brip1	APN	11	86064909	nonsense	probably null
IGL03143:Brip1	APN	11	86061827	missense	possibly damaging	0.53
blip	UTSW	11	86074298	missense	possibly damaging	0.85
radar	UTSW	11	86152669	nonsense	probably null
P0018:Brip1	UTSW	11	86108868	missense	possibly damaging	0.51
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0446:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R0498:Brip1	UTSW	11	86197919	missense	possibly damaging	0.96
R0599:Brip1	UTSW	11	86152737	missense	probably benign
R0653:Brip1	UTSW	11	86152658	missense	possibly damaging	0.85
R0661:Brip1	UTSW	11	86110363	missense	possibly damaging	0.86
R0671:Brip1	UTSW	11	86152667	missense	possibly damaging	0.93
R0718:Brip1	UTSW	11	86143305	missense	possibly damaging	0.96
R0750:Brip1	UTSW	11	86061499	missense	possibly damaging	0.53
R0834:Brip1	UTSW	11	86192827	missense	probably benign
R1128:Brip1	UTSW	11	86064937	missense	possibly damaging	0.86
R1726:Brip1	UTSW	11	86064914	missense	probably benign	0.17
R1813:Brip1	UTSW	11	86187080	missense	possibly damaging	0.53
R1885:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R1886:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R2093:Brip1	UTSW	11	86139145	missense	possibly damaging	0.53
R2206:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R2207:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R3421:Brip1	UTSW	11	86152669	nonsense	probably null
R3876:Brip1	UTSW	11	86152790	missense	probably damaging	0.98
R4018:Brip1	UTSW	11	86138851	missense	possibly damaging	0.86
R4092:Brip1	UTSW	11	86148521	missense	possibly damaging	0.92
R4384:Brip1	UTSW	11	86148429	missense	possibly damaging	0.70
R4394:Brip1	UTSW	11	86074298	missense	possibly damaging	0.85
R4518:Brip1	UTSW	11	86077878	missense	possibly damaging	0.92
R4522:Brip1	UTSW	11	86189801	missense	possibly damaging	0.49
R4840:Brip1	UTSW	11	86146183	missense	possibly damaging	0.86
R5025:Brip1	UTSW	11	86064980	missense	probably benign	0.04
R5176:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R5213:Brip1	UTSW	11	86143321	missense	possibly damaging	0.73
R5470:Brip1	UTSW	11	86148542	missense	possibly damaging	0.71
R5525:Brip1	UTSW	11	86110447	missense	possibly damaging	0.85
R6057:Brip1	UTSW	11	86065039	missense	possibly damaging	0.73
R6819:Brip1	UTSW	11	86110441	missense	possibly damaging	0.51
R6908:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R6920:Brip1	UTSW	11	86148536	nonsense	probably null
R7053:Brip1	UTSW	11	86192965	missense	possibly damaging	0.53
R7235:Brip1	UTSW	11	86138875	missense	possibly damaging	0.53
R7253:Brip1	UTSW	11	86143278	missense	possibly damaging	0.96
R7347:Brip1	UTSW	11	86139103	missense	probably benign	0.34
R7476:Brip1	UTSW	11	86157808	missense	probably benign	0.33
R7580:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R7639:Brip1	UTSW	11	86152822	splice site	probably null
R7771:Brip1	UTSW	11	86062024	missense	probably benign	0.02
R8125:Brip1	UTSW	11	86186991	missense	possibly damaging	0.73
R8236:Brip1	UTSW	11	86139112	missense	probably damaging	0.98
R8509:Brip1	UTSW	11	86197948	nonsense	probably null
R8815:Brip1	UTSW	11	86189772	missense	probably benign	0.17
R8877:Brip1	UTSW	11	86152706	missense	possibly damaging	0.93
R8938:Brip1	UTSW	11	86148401	missense	possibly damaging	0.53
X0060:Brip1	UTSW	11	86152619	missense	possibly damaging	0.71
X0062:Brip1	UTSW	11	86143356	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- TACTGTGTGCACGTGTACTAC -3'
(R):5'- ACCCACTTAATGAATGATACGGT -3'

Sequencing Primer
(F):5'- CTTGACACAGGCTGGAGTTATCAC -3'
(R):5'- CGGTAATTTCTTACAGAGGCATCTC -3'

Posted On

2015-01-23