Incidental Mutation 'R3404:Immp2l'
ID259292
Institutional Source Beutler Lab
Gene Symbol Immp2l
Ensembl Gene ENSMUSG00000056899
Gene NameIMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
SynonymsIMP2
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location41024090-41955588 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 41110847 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 48 (L48*)
Ref Sequence ENSEMBL: ENSMUSP00000116441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080160] [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect probably null
Transcript: ENSMUST00000080160
AA Change: L48*
SMART Domains Protein: ENSMUSP00000079055
Gene: ENSMUSG00000056899
AA Change: L48*

DomainStartEndE-ValueType
SCOP:d1b12a_ 33 77 3e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132121
AA Change: L48*
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899
AA Change: L48*

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134965
AA Change: L48*
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899
AA Change: L48*

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140790
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in processing the signal peptide sequences used to direct mitochondrial proteins to the mitochondria. The encoded protein resides in the mitochondria and is one of the necessary proteins for the catalytic activity of the mitochondrial inner membrane peptidase (IMP) complex. Two variants that encode the same protein have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced fertility, abnormal cellular respiration, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Immp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Immp2l APN 12 41068321 missense probably benign 0.26
IGL01696:Immp2l APN 12 41628807 missense probably damaging 1.00
IGL03082:Immp2l APN 12 41110901 missense possibly damaging 0.75
imp UTSW 12 41110847 nonsense probably null
R1583:Immp2l UTSW 12 41703765 splice site probably benign
R1636:Immp2l UTSW 12 41703687 missense probably damaging 1.00
R3405:Immp2l UTSW 12 41110847 nonsense probably null
R7238:Immp2l UTSW 12 41110916 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGGAATCCTAGTTAGCCTGTC -3'
(R):5'- TGCTACATGAAGCCTAACAGTTG -3'

Sequencing Primer
(F):5'- TCCTAGTTAGCCTGTCTGAAAAC -3'
(R):5'- CCATAACTGGACAGATAGTATCAGC -3'
Posted On2015-01-23